Catalytic composite and visual detection method
A complex, catalytic zone technology, applied in biochemical equipment and methods, biological testing, microbial determination/inspection, etc., to achieve the effects of simple conditions, high sensitivity, high specificity and sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Example 1 Platinum nanoparticles modify DNA via oligonucleotide linkers
[0061] Proceed as follows:
[0062] 1. 100nm platinum-shell gold core nanoparticles synthesized with a mass fraction of 1ppm (synthesized according to the method in the following patent literature: a method for preparing bimetallic nanorods with a dendritic gold core / platinum shell structure, application number: 200710178616) Mix with thiol-containing oligonucleotide sodium phosphate (sequence 1: TCGGTACACG) buffer (0.01M PBS), the mixing volume ratio of the two is 50:1, and co-incubate at room temperature for 12 hours. Prepare oligonucleotide adapters containing platinum nanoparticles.
[0063] 2. Ultrasonic fragmentation of the DNA long chain of Staphylococcus aureus specimen, and respectively add the following liquids in a 500 microliter centrifuge tube: configure 2 microliters of 10pM DNA fragment 0.01M TE buffer, 0.1M alkaline phosphate buffer ( sigma product) 5 microliters, calf small in...
Embodiment 2
[0066] Example 2 Platinum nanoparticles modify DNA by PCR
[0067] Proceed as follows:
[0068] 1. The platinum nanoparticles with a mass fraction of 1ppm are mixed with the phosphate buffer solution (0.01M PBS) of PCR primers 1 and 2 specific to the Shigella dysenteriae DNA to be tested. 12 hours. PCR primer 1 (sequence 2: CTCAGTGCCTCTGCGGAGCTTCG) and primer 2 (sequence 3: GAGAGTTCTGACTTTTATCCCG) specific to the DNA to be detected were prepared to contain platinum nanoparticles. (Purchased from Baobio Bioengineering Dalian Co., Ltd.)
[0069] 2. Carry out the reaction in the small tube of the reaction (reaction volume is 100 microliters): Tag DNA polymerase (5U / μl) 0.5μl, 0.1M Tag enzyme buffer 10μl, MgCl2 (25mM) 8μl, dNTP (each 2.5mM) 8 μl, 1 μg of sample DNA, 2 μl each of platinum nanoparticle-labeled primers-1 and -2 (20 μM), and sterilized water to 100 μl.
[0070] 3. Put it in the preheated PCR machine, 95°C for 30 seconds, 50°C for 30 seconds, and 72°C for 50 seco...
Embodiment 3
[0071] Example 3 Platinum nanoparticles directly modify RNA
[0072] Proceed as follows:
[0073] 1. Platinum nanoparticles with a mass fraction of 1ppm and 1mM synthetic (purchased from Treasure Bioengineering Dalian Co., Ltd.) 5' end containing HS-(CH 2 ) 6 - The RNA sequence (sequence 4: CTCAGTGCCTCTGCGGAGCTTCG) (designed according to Shigella dysenteriae DNA) was mixed with buffer (0.01M PBS), the mixing volume ratio of the two was 1:1, and incubated at room temperature for 12 hours.
[0074] 2. After centrifugation at 14,000 rpm in a 1.5ml centrifuge tube, the platinum nanoparticle-modified RNA was obtained in the form of precipitation, and 0.01M PBS was used to resuspend to obtain the platinum nanoparticle-containing RNA.
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com