Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for regulating plant photoperiod by combining soybean gibberellin with protein gene

A technology of transgenic plants and plants, applied in the fields of botany equipment and methods, biochemical equipment and methods, plant products, etc., can solve the problems affecting the yield potential and achieve the effect of increasing the distance between stems

Inactive Publication Date: 2012-05-30
李 文滨
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Under different regions, different temperature and sunshine conditions, the traits such as flowering period, maturity period and plant height of plant photoperiod response sensitive varieties will change greatly, which will affect the yield potential.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for regulating plant photoperiod by combining soybean gibberellin with protein gene
  • Method for regulating plant photoperiod by combining soybean gibberellin with protein gene
  • Method for regulating plant photoperiod by combining soybean gibberellin with protein gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1: the cultivation of transgenic GMGBP plant

[0025] 1. Construction of plant expression vector pBI121-GMGBP

[0026] The total RNA of soybean (Glycine max) (Northeast Agricultural University Soybean Science Research Institute) was extracted with Trizol reagent, and the first strand of cDNA was synthesized by reverse transcription as a template, with a sense primer: CG TCTAGA CACAGAATCATGGCCACTCT (the underlined part is the Xba I restriction site), antisense primer: GC GAGCTC CTAATGCCCCTTTTCAAATC (the underlined part is the Sac I restriction site), perform PCR reaction, the PCR condition is 94°C for 5min; 35 cycles: 94°C for 30s, 60°C for 30s, 72°C for 2.5min; 72°C for 5min. The PCR product was detected by electrophoresis on 0.8% agarose gel, and the result showed that the PCR product was 1.8kb. After sequencing, the PCR product has the 74-1921 nucleotide sequence of sequence 1 in the sequence listing. The ORF of sequence 1 in the sequence listing is 83...

Embodiment 2

[0034] Example 2: Functional Analysis of Transgenic GMGBP Tobacco T2 Generation

[0035] 1. Phenotype observation of transgenic tobacco

[0036] The seeds of the T2 generation transformed GMGBP tobacco obtained from Example 1 were sterilized and sowed on MS medium, 16h light / 8h dark (long daylight), and grown at 25°C for 1 month to obtain 30 T2 generation transformed GMGBP tobacco 4 The 4-week-old seedlings of 30 wild-type tobacco plants were obtained by the same method as controls, and the 4-week-old seedlings (GMGBP4) of the fourth plant (GMGBP4) and the 4-week-old seedlings of the 15th plant (GMGBP15) of the T2 generation transgenic GMGBP tobacco were compared with wild-type tobacco plants. Type tobacco 4-week-old seedlings (wild type) to take pictures (such as figure 2 shown), from figure 2 It can be seen that compared with the wild type, GMGBP4 and GMGBP15 have shorter roots, smaller leaves, and larger internode spacing.

[0037]Then 20 4-week-old seedlings of T2 tra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for regulating a plant photoperiod by combining soybean gibberellin with a protein gene and provides a method for culturing a transgenic plant. For obtaining the transgenic plant by introducing an encoding gene of a GMGBP protein into a target plant, a phenotype of the transgenic plant is at least one of following three kinds: firstly, the plant height of the transgenic plant is larger than that of the target plant; secondly, the node number of the transgenic plant is larger than that of the target plant; thirdly, the flowering time of the transgenic plant is earlier than that of the target plant, wherein an amino acid sequence of the GMGBP protein is a sequence 2 in a sequence table. Shown by experiments, the transgenic plant which is transferred into a soybean GMGBP (combining the soybean gibberellin with the protein gene) has the advantages of large plant height, stem interval increase, early flowering and early maturity.

Description

technical field [0001] The invention relates to a method for regulating plant photoperiod by using soybean gibberellin-binding protein gene in the field of biotechnology, in particular to a method for cultivating transgenic plants. Background technique [0002] The growth period has an important impact on the planting area and planting area of ​​crops. The length of sunshine and its own photoperiod response characteristics jointly affect the growth and development process of crops, and determine the length of growth period and the scope of adaptation. Under different regions, different temperature and sunshine conditions, the traits such as flowering stage, maturity stage and plant height of plant photoperiod response sensitive varieties will change greatly, which will affect the yield potential. [0003] Soybean is a short-day plant sensitive to photoperiod response, and its flowering time is an important quantitative genetic trait. Soybean was used as an important model pl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00
Inventor 李文滨赵琳李永光罗秋兰
Owner 李 文滨
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More