Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porcine ROSA26 promoter and application thereof

A promoter, DNA sequence technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, etc., can solve the problems of exogenous gene silencing, unfavorable efficient and extensive expression of exogenous genes, etc., and achieve the effect of high-efficiency and stable expression.

Inactive Publication Date: 2011-12-21
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the production of transgenic pigs mostly uses promoters derived from other species such as lower eukaryotes or mice. Due to their heterologous nature, they are susceptible to immune-mediated rejection and epigenetic modification, resulting in silencing of foreign genes. Therefore, it is not conducive to the stable, efficient and extensive expression of foreign genes in transgenic pigs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine ROSA26 promoter and application thereof
  • Porcine ROSA26 promoter and application thereof
  • Porcine ROSA26 promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Porcine ROSA26 promoter

[0025] The ROSA26 promoter is shown in SEQ ID NO.1, or a DNA sequence that can hybridize with the DNA sequence defined in SEQ ID NO.1 under stringent conditions (Tm-10~15°C) and can promote the transcription and translation of the target gene, or A DNA sequence that has more than 90% homology with the DNA sequence defined by SEQ ID NO.1 and can promote the transcription and translation of the target gene.

Embodiment 2

[0026] Cloning of embodiment 2 pig ROSA26 promoter

[0027] According to the principle of complementary base pairing, the upstream and downstream primers for cloning the full-length sequence were designed on both sides of the 5' and 3' sides of the sequence SEQ ID NO. It is used for carrier construction, and finally various parameters such as Tm value and GC content are verified by Oligo 6.0 software. The primer sequences were: 5'GCATTAATCTCGAGTTAGGCCCAACGCGGC3' (upstream) and 5'CGGCTAGCCCGCGGCCGCCCATCCC3' (downstream). The PCR reaction system is (20ul):

[0028] Reagent Volume

[0029] rTaq 0.1 μl

[0030] dNTP 2.5ul

[0031] Buffer(10X) 2ul

[0032] Upstream primer (5μM) 1μl

[0033] Downstream primer (5μM) 1μl

[0034] DNA template 0.4μl

[0035] Distilled water 13μl

[0036] The PCR reaction conditions were: 94°C for 3min; 94°C for 30sec, 60°C for 30sec, 72°C for 1min (30cycles); 72°C for 10min; 4°C for 1h.

[0037] Blast alignment results of the porcine ROSA26 p...

Embodiment 3

[0038] Example 3 Expression of the first exon of ROSA26 gene in various tissues of pigs

[0039]According to the DNA sequence of the first exon, the Primer Premier 5.0 software was used to design, and the parameters were verified by the Oligo 6.0 software, and the primer pairs were screened. The primer sequences were: 5'CGCCTAGAGAAGAGGCTGTGCTCTG3' (upstream) and 5'CAGAGTCCCGCTCCCCTACCTAGC3' (downstream).

[0040] The Q-PCR reaction system is (20ul):

[0041] Reagent volume

[0042] SYBR Premix Ex Taq (2X) 10μl

[0043] Upstream primer (5μM) 1μl

[0044] Downstream primer (5μM) 1μl

[0045] cDNA template 0.2μl

[0046] Distilled water 7.8μl

[0047] The Q-PCR reaction conditions were: 95°C for 10 sec; 95°C for 5 sec, 60°C for 31 sec (40 cycles); 95°C for 15 sec, 60°C for 30 sec, and 95°C for 15 sec.

[0048] The expression of the first exon in various tissues of pigs was detected by Q-PCR. The test results show that pROSA26 can mediate the widespread expression of the f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a porcine ROSA26 promoter sequence and application thereof. A conserved sequence is obtained by comparing sequences of ROSA26 sites in rat, cattle and human being; a porcine endogenous ROSA26 promoter is obtained by designing primer amplification according to the conserved sequence; the obtained ROSA26 promoter is used for expressing GFP of an exogenous gene; and the GFP protein is widely and stably expressed in pigs, so that the promoter can solve the problems of the instability of expression of the transgenic porcine endogenous gene and the unpredictability of position effect and makes the industrial production possible.

Description

technical field [0001] The invention relates to a porcine promoter and its application, in particular to the ROSA26 promoter and its application. Background technique [0002] In the past ten years, transgenic technology has been rapidly developed and widely used. Its combination with cloning technology has made it possible for the production of transgenic animals to move from basic research to industrialization. Stable, efficient and extensive expression in transgenic animals. Current research shows that this is mainly related to the activity of the promoter of the foreign gene. Therefore, it is very important to obtain a promoter that can stably and efficiently express the foreign gene in the transgenic animal. . [0003] In mice, it has been proven that the ROSA26 promoter has extensive and efficient activity in almost all cells, whether in various embryonic developmental stages or in various adult tissues and organs, and there are currently multiple ROSA26 transgenes M...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/09
Inventor 孔庆然武美玲刘忠华
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com