Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application
A technology of mir-27a and genetic markers, which is applied in the detection field of the mutation site of the porcine miR-27 gene precursor sequence, and can solve the problem of less information about porcine miRNA
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Detection of gene expression levels in the ovaries of large white pigs of foreign pig bloodlines and Erhualian pigs of Chinese native pig bloodlines
[0029] According to the predicted mature miRNA sequence of the miRNA database (http: / / microrna.sanger.ac.uk / sequences / index.shtml) and the design scheme of Shi et al. (2005) for detecting plant miRNAs, the primer RTmiR27a was designed: TTCACAGTGGCTAAGTTCCG. Use Poly(A) to tail the ovarian RNA of large white pigs (foreign pig bloodlines) and Erhualian pigs (Chinese local pig bloodlines), use the primer Poly(T) adapter: GCGAGCACAGAATTAATACGACTCACTATAGG(T)12VN* for reverse transcription, and finally RTmiR27a and Reverse primer: GCGAGCACAGAATTAATACGAC were used for real-time PCR, and 18S was used as a control. The primer sequence was 18SFbc: TTTCGCTCTGGTCCGTCTTG; 18SRbc: TTCGGAACTGAGGCCATGAT. Using TOYOBO's SYBRGreen realtime PCR masterMix, using BioRad's real-time quantitative PCR instrument iQ TM 5Multicolor Rea...
Embodiment 2
[0030] Example 2: The acquisition of gene fragments and the establishment of polymorphism detection methods
[0031] According to the information of miRNA isolation reported at home and abroad (http: / / www.sanger.ac.uk / software / Rfam / mirna), combined with the highly conserved characteristics of miRNA in similar species, using bioinformatics and computer technology in the miRNA database Query the sequence information of miR-27a precursor in humans and mice, and use the precursor sequence as a seed, at http: / / www.ncbi.nlm.nih.gov / projects / genome / seq / BlastGen / BlastGen .cgi? The sequences in taxid=9823 were compared with the sequences in the porcine genome database HTGS and WGS, the homologous sequences were searched, and the sequence similarity greater than 80% was confirmed as homologous sequences. With the target sequence including the precursor miRNA and its 5' and 3' flanking region 200-400bp as the target sequence of the design primer, primers were designed online using Prime...
Embodiment 3
[0033] Example 3: Polymorphic distribution of genetic markers prepared by the present invention in different pig herds
[0034] PCR-HpaII-RFLP, the flanking sequence of the porcine miR-27a precursor, was detected in 5 pig populations, including 1 foreign bloodline pig herd (Large White pig) and 1 local Chinese bloodline pig herd (Meishan pig), and 3 synthetic lines. The test results are shown in Table 1. Among the several pig breeds tested, the gene frequency of the dominant A allele in the large white herd of foreign academic pigs was 0.919, while the gene frequency of the A allele in the Chinese native pig Meishan pig was only 0.222 ( See Table 1).
[0035] Table 1 Distribution results of miR-27a precursor flanking sequence PCR-HpaII-RFLP in different pig species
[0036]
[0037]
[0038] Table 1 shows that: the DIV line of the new Chinese lean pig line and the high-quality line of Hubei White pig are synthetic lines selected by cross-breeding foreign pigs and Chine...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com