Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application

A technology of mir-27a and genetic markers, which is applied in the detection field of the mutation site of the porcine miR-27 gene precursor sequence, and can solve the problem of less information about porcine miRNA

Inactive Publication Date: 2012-04-18
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, a large number of miRNAs have been isolated from humans and mice, but the amount of information on pig miRNAs is relatively small

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application
  • Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application
  • Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Detection of gene expression levels in the ovaries of large white pigs of foreign pig bloodlines and Erhualian pigs of Chinese native pig bloodlines

[0029] According to the predicted mature miRNA sequence of the miRNA database (http: / / microrna.sanger.ac.uk / sequences / index.shtml) and the design scheme of Shi et al. (2005) for detecting plant miRNAs, the primer RTmiR27a was designed: TTCACAGTGGCTAAGTTCCG. Use Poly(A) to tail the ovarian RNA of large white pigs (foreign pig bloodlines) and Erhualian pigs (Chinese local pig bloodlines), use the primer Poly(T) adapter: GCGAGCACAGAATTAATACGACTCACTATAGG(T)12VN* for reverse transcription, and finally RTmiR27a and Reverse primer: GCGAGCACAGAATTAATACGAC were used for real-time PCR, and 18S was used as a control. The primer sequence was 18SFbc: TTTCGCTCTGGTCCGTCTTG; 18SRbc: TTCGGAACTGAGGCCATGAT. Using TOYOBO's SYBRGreen realtime PCR masterMix, using BioRad's real-time quantitative PCR instrument iQ TM 5Multicolor Rea...

Embodiment 2

[0030] Example 2: The acquisition of gene fragments and the establishment of polymorphism detection methods

[0031] According to the information of miRNA isolation reported at home and abroad (http: / / www.sanger.ac.uk / software / Rfam / mirna), combined with the highly conserved characteristics of miRNA in similar species, using bioinformatics and computer technology in the miRNA database Query the sequence information of miR-27a precursor in humans and mice, and use the precursor sequence as a seed, at http: / / www.ncbi.nlm.nih.gov / projects / genome / seq / BlastGen / BlastGen .cgi? The sequences in taxid=9823 were compared with the sequences in the porcine genome database HTGS and WGS, the homologous sequences were searched, and the sequence similarity greater than 80% was confirmed as homologous sequences. With the target sequence including the precursor miRNA and its 5' and 3' flanking region 200-400bp as the target sequence of the design primer, primers were designed online using Prime...

Embodiment 3

[0033] Example 3: Polymorphic distribution of genetic markers prepared by the present invention in different pig herds

[0034] PCR-HpaII-RFLP, the flanking sequence of the porcine miR-27a precursor, was detected in 5 pig populations, including 1 foreign bloodline pig herd (Large White pig) and 1 local Chinese bloodline pig herd (Meishan pig), and 3 synthetic lines. The test results are shown in Table 1. Among the several pig breeds tested, the gene frequency of the dominant A allele in the large white herd of foreign academic pigs was 0.919, while the gene frequency of the A allele in the Chinese native pig Meishan pig was only 0.222 ( See Table 1).

[0035] Table 1 Distribution results of miR-27a precursor flanking sequence PCR-HpaII-RFLP in different pig species

[0036]

[0037]

[0038] Table 1 shows that: the DIV line of the new Chinese lean pig line and the high-quality line of Hubei White pig are synthetic lines selected by cross-breeding foreign pigs and Chine...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technology field of preparation and application of pig genetic markers, and in particular relates to a genetic marker by taking pig miR-27a precursor flanking genetic fragments as a trait of the litter size of a pig, a preparation method and application thereof. According to the invention, the genetic marker which is related to the character of the litter size of the pig is obtained, wherein the genetic marker comprises the pig miR-27a precursor flanking genetic fragments and is nucleotide sequences expressed by the following sequence lists: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5; a base mutation of C461-T461 is generated at 461bp of the following sequence lists: the SEQ ID NO:1, the SEQ ID NO:2, the SEQ ID NO:3, the SEQ ID NO:4, and the SEQ ID NO:5; and the mutation leads to polymorphism of PCR-HpaII-RFLP. In the design, a primer is additionally provided in the miR-27a precursor flanking genetic fragments, wherein the nucleotide sequence of the primer is expressed as SEQ ID NO:6 and SEQ ID NO:7. The invention also discloses the method for preparing the genetic marker and the application of the genetic marker in the pig marker assistant selection.

Description

technical field [0001] The invention relates to the technical field of preparation of pig genetic markers, in particular to a porcine miR-27a precursor flanking sequence SNP as a genetic marker related to pig litter size traits and its application, which includes the detection of porcine miR-27 gene precursor sequence mutation sites Methods and applications. Background technique [0002] MicroRNA (miRNA, miRNA) is a type of endogenous small RNA with a length of about 22 nucleotides, located at the 3' end or 5' end of the RNA precursor. Most miRNAs are produced from single-stranded RNA precursors with a stem-loop structure and a hairpin structure of about 70 nt in size, which are processed by Dicer enzyme. Since 1993, researchers have discovered a total of more than 9539 miRNAs in Drosophila, Rattus norvegicus, etc. (http: / / www.sanger.ac.uk / software / Rfam / mirna, August 8, 2009), functional Involved in tissue growth, cell apoptosis, fat metabolism, egg cell development, sperm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 李凤娥高思雷彬罗立凡蒋思文邓昌彦熊远著
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com