Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Hsa-mir-210 kit and detection method for detection of pregnancy-induced hypertension syndrome

A technology of hsa-mir-210 and gestational hypertension, applied in the field of medical biological detection, can solve the problem of no has-mir-210 and the like, and achieve the effect of reducing the occurrence of gestational hypertension and its related complications

Inactive Publication Date: 2011-12-21
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no relevant report on using has-mir-210 as a marker for detecting the occurrence and development of PIH

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hsa-mir-210 kit and detection method for detection of pregnancy-induced hypertension syndrome
  • Hsa-mir-210 kit and detection method for detection of pregnancy-induced hypertension syndrome
  • Hsa-mir-210 kit and detection method for detection of pregnancy-induced hypertension syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: prepare test kit of the present invention (for one person's use)

[0035] The kit of the present invention consists of the following:

[0036] 1. 1 tube of reverse transcription primer, 100 μl / tube Concentration: 10 μM The reverse transcription primer is:

[0037] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGCCGCT

[0038]2. One tube of upstream and downstream primers for Real-time PCR, 100 μl / tube Concentration: 10 μM;

[0039] The upstream primer is: ACGATGCTGTGCGTGTGAC

[0040] The downstream primer is: GTGCAGGGTCCGAGGT

[0041] 3.Trizol reagent 1 tube 2000μl / tube

[0042] 4. Chloroform 1 tube 500ul / tube

[0043] 5. Absolute ethanol 1 tube 7ml / tube

[0044] 6. DEPC H 2 O 1 tube 1000μl / tube

[0045] 7. dd H 2 O 1 tube 2000μl / tube.

[0046] The present invention finds the mature body sequence CUGUGCGUGUGACAGCGGCUGA of hsa-mir-210 according to the known bioinformatics, and its specific reverse transcription primers and the upstream and downstr...

Embodiment 2

[0058] Embodiment 2: the detection of kit of the present invention

[0059] 1. Collection of plasma samples and sample preparation:

[0060] Because plasma has the advantages of convenient sampling, non-invasiveness, and continuous detection, the detection of biomarkers of pregnancy-induced hypertension from plasma can improve the detection technology of pregnancy-induced hypertension to a new level, so as to achieve early prevention, purpose of early treatment.

[0061] Plasma samples were collected in the Department of Obstetrics and Gynecology of Shanghai Changhai Hospital and the Department of Obstetrics and Gynecology of the First Affiliated Hospital of Anhui Medical University, and were divided into the following four groups: (1) pregnant women with hypertensive pregnancy (n=10); (2) mild premonition Pregnant women with epilepsy (n=10); (3) pregnant women with severe preeclampsia (n=10); (4) healthy pregnant women as a control group (n=10). The difference between the g...

Embodiment 3

[0085] Example 3: Comparison of mir-210 content in plasma between healthy pregnant women and pregnant women with pregnancy-induced hypertension

[0086] Comparing the has-mir-210 in the plasma of all pregnant women with pregnancy-induced hypertension with the has-mir-210 in the plasma of healthy pregnant women, using the t test, the result is Pfigure 1 )

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of medical biological detection. Preeclampsia-induced hypertension is one of the main causes of pregnancy, maternal, fetal, and infant deaths. The current detection methods mainly rely on clinical symptoms and combine some biochemical indicators. In fact, the cause of gestational hypertension is as early as in women. It exists at the beginning of pregnancy, and clinically there is a lack of early detection markers for early detection and intervention of the disease. The purpose of the present invention is to provide a hsa-mir-210 kit for detecting pregnancy-induced hypertension syndrome and a detection method thereof. The present invention detects changes in the hsa-mir-210 content in plasma or serum, thereby enabling more effective early detection of patients with pregnancy-induced hypertension, early detection of high-risk subjects with pregnancy-induced hypertension, and effective intervention in a timely manner. Reduce the incidence of pregnancy-induced hypertension and its related complications.

Description

technical field [0001] The invention relates to the technical field of medical biological detection, and is a kit for detecting the occurrence and development of pregnancy-induced hypertension syndrome through the change of hsa-mir-210 content in plasma or serum, and a detection method thereof. Background technique [0002] Pregnancy-induced hypertension (PIH) is a pregnancy-specific disease caused by multiple system disorders, which mostly occurs after 20 weeks of pregnancy. Clinical manifestations include high blood pressure, proteinuria, edema, and severe symptoms such as headache, dizziness, and blurred vision. If not treated in time, it may cause generalized convulsions or even coma, and may also cause dysfunction of the kidneys, liver, and brain And coagulation disorder, is one of the main factors of pregnancy, maternal and fetal, infant death, among which eclampsia is still the primary factor of maternal death so far. [0003] The current detection methods of PIH mai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 孙树汉张毅费明钰贾音
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com