Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel strain of Bacillus thuringiensis bacterial strain and use thereof

A technology of bacillus aureus and strains, applied in the field of bacillus thuringiensis and its application in agricultural pest control

Active Publication Date: 2010-08-04
SICHUAN AGRI UNIV +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, studies have proved that Bti has not yet found resistance problems in the use of field (Regis L, et al., 2000. The use of bacterial larvicides in mosquito and black fly control programs in Brazil. Mem. Instituto Oswaldo Cruz, 95: 207-210. ), but the problem of mosquito resistance to it has been confirmed in the laboratory, and this situation may also appear in the field (Georghiou GP, and Wirth MC, 1997. Influence of exposure to single versus multiple toxins of Bacillus thuringiensis subsp.israelensis ondevelopment of resistance in the mosquito Culex quinquefasciatus (Diptera: Culicidae). Applied and Environmental Microbiology, 63: 1095-1101.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel strain of Bacillus thuringiensis bacterial strain and use thereof
  • Novel strain of Bacillus thuringiensis bacterial strain and use thereof
  • Novel strain of Bacillus thuringiensis bacterial strain and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 2 Identification of cry and cyt genes in bacterial strain BtMC28

[0026] Design a pair of specific primers based on the conserved sequence of the cry4 gene:

Embodiment 2

[0027] 5-GTGTCAAGAGAACCAACAGTATG-3

[0028] 5-ACTAAGTCTCTCTCCTGTATGACCAG-3

[0029] Design a pair of specific primers based on the conserved sequence of cry30 genes:

[0030] 5-AAGATTGGCTCAATATGTGTC-3

[0031] 5-GATTATCAGGATTCTACACTAG-3

[0032] Design a pair of universal primers based on the cry53 gene:

[0033] 5-AATAAAAAATGAATATGAAATATT-3

[0034] 5-TTTCACAGCCGGAATTTGTGTAAT-3

[0035] Design a pair of universal primers based on the cyt2 gene:

[0036] 5-ATTACAAATTGCAAATGGTATTCC-3

[0037] 5-TTTCAACATCCACAGTAATTTCAAATGC-3

[0038] Use the following PCR reaction system for identification:

[0039] 10×buffer 2.5μl

[0040] MgCl 2 (25mM) 1.5μl

[0041] Taq enzyme 0.2μl

[0042] dNTPs (2.5mM) 2μl

[0043] Primer 2μl

[0044] Template 5 μl μ

[0045] Final reaction volume 25 μl

[0046] Thermal cycle reaction: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing temperature depends on the primer, extension at 72°C for 2 min, 30 cycles; ext...

Embodiment 3

[0049] P1: 5'ATGAAGCCGTATCAAAGTG3'

[0050] P2: 5'GTTCACTGGACAAGCAAATGC3'

[0051] P3: 5'ATGAATTCATATCAAAATAAAAAATG 3'

[0052] P4: 5'TTATTCGACAAATAAACTATTTACA 3'

[0053] P5: 5'ATGAATTCATATCAAAATAAAAAATG 3'

[0054] P6: 5'TTACCCTTTCATACAAAGAAACTCG 3'

[0055] P7: 5'ATGTATACTAAAAATTTTA 3'

[0056] P8: 5'TCAATTCGATAAATTTAAA 3'

[0057] 1. Sequence analysis of cry30Fa gene

[0058] The full length of the sequence SEQ ID No.19 is 2064bp, the analysis shows that the GC content is 33.87%, and it encodes a protein consisting of 687 amino acids. After determination, its amino acid sequence is shown in SEQ ID No.24. Using the bacterial sigma7.0 promoter program to predict the entire sequence on the softberry website, it was shown that the sequence containing the activation site of RNA polymerase in the upstream of the coding region of the gene was named cry30Fa1. The present invention further analyzes the amino acid composition of the Cry30Fal protein (see Table 2).

[0059] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel strain BtMC28 of Bacillus thuringiensis, which has a preservation number of CGMCC No.2719. Tests of the virulence activity of the BtMC28 show that the BtMC28 has extremely high virulence on Lepidoptera, dipteral pests, and the like. The Bacillus thuringiensis BtMC28 can be made into a pesticide for controlling major farm crop pests. As a result, the novel strain BtMC28 of Bacillus thuringiensis diversifies and serializes the products of Bacillus thuringiensis pesticides, enlarges the application range of the Bacillus thuringiensis pesticides, reduces the pesticide dosage and environmental pollution, and has significant economic value and application prospect.

Description

technical field [0001] The invention relates to a new microbial strain and its application, in particular to a bacillus thuringiensis and its application in agricultural pest control. Background technique [0002] In the process of human production, insect pests are an important factor that causes agricultural production losses and affects human health. According to FAO statistics, the annual economic losses caused by insect pests in agricultural production worldwide are as high as 14%, disease losses reach 12%, and weed damage losses reach 11%. %. The loss was as high as 126 billion US dollars, equivalent to half of China's total agricultural output value, and more than four times that of the United Kingdom. In addition, mosquito-borne diseases occupy an important position in preventive medicine, among which mosquito-borne diseases such as dengue fever and yellow fever have strong transmissibility, wide prevalence, high incidence and great harm. According to WHO statistic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/02A01P7/04C12R1/07
Inventor 李平郑爱萍朱军谭芙蓉王玲霞王世全邓其明李双成刘怀年宋福平束长龙张杰
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com