Compounds for the modulation of beta-catenin expression
a technology of beta-catenin and compound, applied in the field of compound for the modulation of beta-catenin expression, can solve the problems of reducing cell adhesion and achieve the effect of facilitating entry into the cell
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Monomer Synthesis
[0242]The LNA monomer building blocks and derivatives were prepared following published procedures and references cited therein—see WO 07 / 031,081 and the references cited therein.
example 2
Oligonucleotide Synthesis
[0243]Oligonucleotides were synthesized according to the method described in WO 07 / 031,081. Table 1 shows examples of antisense oligonucleotide motifs and of the invention.
example 3
Design of the Oligonucleotides
[0244]In accordance with the invention, a series of oligonucleotides were designed to target different regions of the human beta-catenin mRNA using the published sequence, GenBank accession number NM—001904, presented herein as SEQ ID NO: 173.
[0245]Table 2 shows oligomer designs of the invention. Table 3 shows 24mer sequence motifs from which oligomers of the invention may be designed—the bold type represents 16mer sequence motifs as shown in Table 1 that are incorporated into the longer oligomers.
TABLE 3Beta-Catenin 24 mers SequencesShort-merCompound24-mer16 mer SEQ IDsSEQ IDsIDs24 mer SEQ IDsSEQ IDSEQ ID NO: 1 2-15133-153tttagaaagctgatggaccataac174SEQ ID NO: 16134-154cctccagacttaaagatggccagt175SEQ ID NO: 17135-155aacacagaatccactggtgaacca176SEQ ID NO: 18 19-32136-156aaacgcactgccattttagctcct177SEQ ID NO: 33137-157tgtcgtaatagccaagaatttaac178SEQ ID NO: 34 35-48138-158cagcactctgcttgtggtccacag179SEQ ID NO: 49139-159cattccaccagcttctacaatagc180SEQ ID NO: 501...
PUM
Property | Measurement | Unit |
---|---|---|
Fraction | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com