Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Compounds for the modulation of beta-catenin expression

a technology of beta-catenin and compound, applied in the field of compound for the modulation of beta-catenin expression, can solve the problems of reducing cell adhesion and achieve the effect of facilitating entry into the cell

Inactive Publication Date: 2009-01-01
SANTARIS PHARMA AS
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0011]The invention further provides a conjugate comprising the oligomer according to the invention, which, is covalently linked to one or more moieties that are not themselves nucleic acids or monomers (“conjugated moiety”). In some embodiments, the conjugated moiety consists of or comprises a sterol group such as cholesterol, or other moiety that facilitates entry into the cell.

Problems solved by technology

Beta-catenin undergoes phosphorylation upon growth factor stimulation resulting in reduced cell adhesion.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compounds for the modulation of beta-catenin expression
  • Compounds for the modulation of beta-catenin expression
  • Compounds for the modulation of beta-catenin expression

Examples

Experimental program
Comparison scheme
Effect test

example 1

Monomer Synthesis

[0242]The LNA monomer building blocks and derivatives were prepared following published procedures and references cited therein—see WO 07 / 031,081 and the references cited therein.

example 2

Oligonucleotide Synthesis

[0243]Oligonucleotides were synthesized according to the method described in WO 07 / 031,081. Table 1 shows examples of antisense oligonucleotide motifs and of the invention.

example 3

Design of the Oligonucleotides

[0244]In accordance with the invention, a series of oligonucleotides were designed to target different regions of the human beta-catenin mRNA using the published sequence, GenBank accession number NM—001904, presented herein as SEQ ID NO: 173.

[0245]Table 2 shows oligomer designs of the invention. Table 3 shows 24mer sequence motifs from which oligomers of the invention may be designed—the bold type represents 16mer sequence motifs as shown in Table 1 that are incorporated into the longer oligomers.

TABLE 3Beta-Catenin 24 mers SequencesShort-merCompound24-mer16 mer SEQ IDsSEQ IDsIDs24 mer SEQ IDsSEQ IDSEQ ID NO: 1  2-15133-153tttagaaagctgatggaccataac174SEQ ID NO: 16134-154cctccagacttaaagatggccagt175SEQ ID NO: 17135-155aacacagaatccactggtgaacca176SEQ ID NO: 18 19-32136-156aaacgcactgccattttagctcct177SEQ ID NO: 33137-157tgtcgtaatagccaagaatttaac178SEQ ID NO: 34 35-48138-158cagcactctgcttgtggtccacag179SEQ ID NO: 49139-159cattccaccagcttctacaatagc180SEQ ID NO: 501...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Login to View More

Abstract

The invention relates to oligomer compounds (oligomers), which target beta-catenin mRNA in a cell, leading to reduced expression of beta-catenin. Reduction of beta-catenin expression is beneficial for a range of medical disorders, such as hyperproliferative disorders, such as cancer. The invention provides therapeutic compositions comprising oligomers and methods for modulating the expression of beta-catenin using said oligomers, including methods of treatment.

Description

1. CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application Ser. No. 60 / 915,371, filed May 1, 2007, and U.S. Provisional Application Ser. No. 61 / 023,244, filed Jan. 24, 2008, the disclosures of which are incorporated herein by reference in their entireties.2. FIELD OF THE INVENTION[0002]The invention relates to oligomeric compounds (oligomers) which target beta-catenin mRNA in a cell, leading to reduced expression of beta-catenin. Reduction of beta-catenin expression is beneficial for a range of medical disorders, such as hyperproliferative diseases, including cancer. The invention provides therapeutic compositions comprising oligomers and methods for modulating the expression of beta-catenin using said oligomers, including methods of treatment.3. BACKGROUND[0003]Beta-catenin (also known as cadherin-associated protein and β-Catenin) is a member of the catenin family of cytosolic proteins and a pivotal p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7088C07H21/00C12N5/06A61P31/00C12N15/113
CPCA61K31/7088C12N15/113C12N2310/11C12N2310/351C12N2310/3231C12N2310/3341C12N2310/315A61P31/00A61P35/00A61P35/04A61P43/00C07H21/00C12N15/00C12N15/11
Inventor WORM, JESPER
Owner SANTARIS PHARMA AS
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More