Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Quantification method for expression level of WT1 mRNA

a quantitative method and expression level technology, applied in the field of quantitative method of expression level of wt1 mrna, can solve the problems of requiring a lot of time, and achieve the effects of less effort, shorter period of time, and simple operation

Inactive Publication Date: 2019-05-07
OTSUKA PHARM CO LTD
View PDF23 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This method allows for convenient and rapid quantification of WT1 mRNA with higher sensitivity than traditional two-step RT-PCR methods, enabling accurate detection even at low concentrations and simplifying the process while maintaining high accuracy.

Problems solved by technology

However, this method requires not only measuring WT1 mRNA and β-actin mRNA separately, but also performing extension reactions after a reverse transcription reaction is done, i.e., two-step RT-PCR, thus requiring a lot of time.
However, this method requires the expression level of a housekeeping gene used for correcting the expression level of the WT1 gene to be separately measured, and thus is complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quantification method for expression level of WT1 mRNA
  • Quantification method for expression level of WT1 mRNA
  • Quantification method for expression level of WT1 mRNA

Examples

Experimental program
Comparison scheme
Effect test

example 1

Measurement by One-Step and Multiplex RT-PCR

(1) Design of Primers and Probes

[0072]Human WT1 mRNA was selected as a gene of interest to be measured, and GAPDH mRNA was selected as an endogenous control gene (gene for correction) for correcting the expression level of the gene to be measured. Primer sets and probes that allow for specific amplification and detection of the individual genes were designed and synthesized.

[0073]Fluorescently labeled probes were prepared to detect the gene of interest (human WT1 mRNA) and the gene for correction (GAPDH mRNA) simultaneously as follows. The 5′ end of the probe for detecting the gene of interest was labeled with FAM (6-carboxyfluorescein), and the 5′ end of the probe for detecting the gene for correction was labeled with HEX (6-hexachlorofluorescein). The 3′ end of each probe was labeled with ATTO-540Q (ATTO-TEC GmbH) as a quenching dye.

[0074]Table 3 shows the sequences of the primers and probes used in the Examples.

[0075]

TABLE 3GenePrimerSe...

example 2

Dilution Test Using RNA Extracted from K562

[0091]In this Example, the measurement sensitivity was compared between one-step and multiplex RT-PCR in which WT1 mRNA and GAPDH mRNA were amplified simultaneously, and two-step RT-PCR in which a reverse transcription reaction, and PCR were individually performed in different vessels and WT1 mRNA and GAPDH mRNA were amplified separately. The two-step RT-PCR was performed using an Otsuka kit for measuring WT1 mRNA (Otsuka Pharmaceutical Co., Ltd.).

(1) Sequences of Primers and Probes

[0092]Table 6 shows the sequences of the primers and probes used for measuring WT1 mRNA and GAPDH mRNA by one-step RT-PCR. Since an Otsuka kit for measuring WT1 mRNA was used in two-step RT-PCR, the primers and probe in two-step RT-PCR were not known.

[0093]

TABLE 6Primer and Probe Sequences for Amplifying WT1 mRNA and GAPDHmRNA(Sequence Set A)GenePrimerSequenceWT1Forward PrimerSEQ ID NO: 3: CGCTATTCGCAATCAGGGTTACReverse PrimerSEQ ID NO: 4: GGATCCTCATGCTTGAATGAGTPr...

example 3

Cross-Reactivity Test

[0100]In this Example, one-step RT-PCR in which WT1 mRNA and GAPDH mRNA were amplified simultaneously was performed using the set shown in Table 8 (sequence set B) as primers and probes and also separately using the set shown in Table 9 as primers and probes, and cross reactivity was evaluated.

[0101]

TABLE 8 Primer and Probe Sequences for Amplifying WT1 mRNA and GAPDHmRNA(Sequence Set B)GeneGenePrimer / ProbeSequenceRegionWT1Forward PrimerSEQ ID NO: 9: GATAACCACACAACGCCCATC1214-1234*Reverse PrimerSEQ ID NO: 10: CACACGTCGCACATCCTGAAT1303-1283*ProbeSEQ ID NO: 11: AATACACACGCACGGTGTCTTCAGAG1255-1280*GAPDHForward PrimerSEQ ID NO: 6: CAGCCGAGCCACATCG 77-92**Reverse PrimerSEQ ID NO: 12: TGATGGCAACAATATCCACTTTACC202-178**ProbeSEQ ID NO: 8: TTGGTCGTATTGGGCGCCTGG134-154**A single asterisk indicates a region of the human WT1 gene (NM_024426.4: SEQ ID NO: 1).Double astisks indicates a region of the humna GAPDH gene (NM_002046.3: SEQ ID NO: 2).

[0102]

TABLE 9Primer and Probe Seq...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
pHaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

A method for quantifying the expression level of human WT1 mRNA conveniently, in a short period of time, and with high sensitivity is provided. The method can be used for diagnosing cancer, such as leukemia and solid cancer, or for determining when to perform bone marrow transplantation. The method is for quantifying the expression level of human WT1 mRNA by one-step RT-PCR and comprises simultaneously subjecting the human WT1 mRNA and a housekeeping gene (mRNA) to reverse transcription and extension reactions carried out sequentially in the same vessel.

Description

SEQUENCE LISTING[0001]The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jun. 23, 2016, is named 04676_0337_SL.txt and is 8,917 bytes in size.TECHNICAL FIELD[0002]The present invention relates to a novel method for quantifying the expression level of human WT1 mRNA that can be used for diagnosing cancer, such as leukemia and solid cancer, or for determining when to perform bone marrow transplantation.BACKGROUND ART[0003]Wilms tumor gene-1 (“WT1”) is a gene that was identified as a causative gene of pediatric Wilms tumor by Call et al. in 1990 (Non-patent Literature 1). Thereafter, it has been indicated that WT1 mRNA is expressed at a high rate in not only pediatric Wilms tumor but also solid cancer cells, such as solid cancer cell lines, e.g., gastric cancer cell lines, colon cancer cell lines, lung cancer cell lines, and breast cancer cell li...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(United States)
IPC IPC(8): C12P19/34C12Q1/6886C12Q1/6851
CPCC12Q1/6886C12Q1/6851C12Q2600/16C12Q2600/158
Inventor SAIJO, YOKOITO, RYUTAKOGA, DAISUKE
Owner OTSUKA PHARM CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More