Absolute quantitation of nucleic acids by RT-PCR
A RT-PCR, absolute quantitative technology, applied in the field of molecular biology, can solve time-consuming, laborious and infeasible problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0037] Primers, probe design and oligonucleotide templates
[0038] Taqman forward and reverse primers and a 5'FAM labeled MGB probe were designed from the Affymetrix consensus sequence using PrimerExpress(R) (Applied Biosystems). Oligonucleotide templates for in vitro transcription can be constructed by adding 10 base pairs of gene-specific sequence to the 5' and 3' ends of the amplicon, followed by the addition of 10 base pairs 3' to the T7 promoter region Outside of the base pair, the T7 promoter consists of 5'CCTATAGTGAGTCGTATTA 3' (SEQ ID NO: 1).
[0039] In vitro transcription using synthetic oligonucleotides
[0040] In vitro transcription reactions using partial single-stranded oligonucleotide templates were performed using a commercially available kit (T7-MEGAshortscript Kit, Ambion Inc., Austin, TX). Part of the single-stranded template was passed through the T7 primer (5'AATTTAATACGACTCACTATAGG 3'), which was only in the T7 promoter region (in 10mM Tris-HCl (pH 8....
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com