Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

An antibiotic peptide and its coded sequence and use

A coding sequence and antimicrobial peptide technology, applied in the direction of antibacterial drugs, peptide sources, applications, etc., can solve the problems of fish quality and taste decline, environmental pollution, and affect the quality of aquatic products

Inactive Publication Date: 2004-11-03
SUN YAT SEN UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The consequences have caused environmental pollution; the quality and taste of fish has declined; at the same time, the drug resistance of pathogens has increased, and the amount of chemical drugs and antibiotics has increased, but the disease problem has not been solved; the residues of pesticides and antibiotics have affected the quality of aquatic products , such as Japan and EU countries have refused to import Chinese aquatic products due to the problem of antibiotic residues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Acquisition of cDNA of antimicrobial peptides of grouper

[0025] The inventors used the SMART cDNA library construction kit from Clontech Company to construct the cDNA library of grouper white blood cells, randomly selected clones for sequencing, and compared the measured sequence with the Genbank sequence using the BLAST program to obtain the cDNA of the antimicrobial peptide .

[0026] 1. Extraction of total RNA from leukocytes of grouper

[0027] Healthy grouper (about 600 g in weight) was intraperitoneally injected with 0.4 ml of polyI:C (purchased from Amersham Pharmacia) at a concentration of 2 mg / ml. After 72 hours, blood was drawn from the tail vein and added to four times the volume of normal saline containing heparin. This suspension was slowly added on the surface of Ficoll-Paque Plus Lymphocyte Separation Medium (purchased from Amersham Pharmacia) with twice the suspension volume. After equilibration, centrifuge at 400×g for 30 min at room tem...

Embodiment 2

[0087] Embodiment two: the solid-phase chemical synthesis of antimicrobial peptide and the mensuration of minimum bactericidal concentration

[0088] 1. Solid-phase chemical synthesis of antimicrobial peptides:

[0089] According to the sequence of amino acid residues 1 to 25 of sequence 2 in the sequence listing, entrust Shenzhen Hanyu Biotechnology Co., Ltd. to synthesize the polypeptide, and amidate the C-terminus. After synthesis, it is purified to a purity of 85%.

[0090] 2. Determination of minimum bactericidal concentration

[0091] Different bacteria were cultured in nutrient broth based on shaking overnight at 37°C. Dilute overnight bacteria to about 2×10 5 Colony forming units per milliliter (CFU ml -1 ). Take 25 μl of bacterial solution and the antimicrobial peptide solution (400 μg / ml to 0.5 μg / ml) synthesized above diluted with 1 mmol / L acetate buffer solution (pH4.0) of different concentrations in equal volumes and place them in the wells of a 96-well cell ...

Embodiment 3

[0107] Example 3: Recombinant expression of grouper antimicrobial peptide in prokaryotic expression vector

[0108] A pair of primers were synthesized according to the two-terminal sequences of polynucleotides 152-226 in sequence 1 in the sequence listing and the multiple restriction sites of the prokaryotic expression vector pTRX, the sequences of which are as follows:

[0109] Upstream primer, 5'CGG GGTACCGACGACGACGACAAA TTT ATC TTC CAC ATC ATT 3', where the single underlined part is the KpnI restriction site, and the double underlined part is the enterokinase cleavage site.

[0110] Downstream primer, 5'CGG GCGGCCGC TCA GGC AAA AGC TTT CTC 3', where the single underlined part is the NotI restriction site.

[0111] PCR amplification and gene cloning were carried out according to conventional methods. The PCR product is about 150bp. Cloning the target gene (the nucleotide sequence of Sequence Table 1 or the 152-226 polynucleotide) into the prokaryotic expression vector...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides one kind of antibiotic peptide and its coding polynucleotides and use. The antibiotic peptide contains the amino acid sequence from site 1 to site 25 in the sequence table <400>2 of the sequence table. The polynucleotides coding the antibiotic peptide include the nucleotide sequence of amino acid sequence form site 1 to site 25, from site 1 to site 45 or from -22 site to site 45 in the sequence table <400>2 of the sequence table or their complementary sequences. The antibiotic peptide has obvious killing effect on several kinds of bacteria, and has lowest killing concentration smaller than 10 micro mol / L to algae dissolving vibrio, vibrio vulnificus, parahemolytic vibrio, Pasteuvella multocida, etc. and may be used in preparing antibiotic, especially that for preventing and treating bacterial diseases of aquatics.

Description

technical field [0001] The present invention relates to an antimicrobial peptide, in particular to an antimicrobial grouper peptide, a nucleotide sequence encoding the antimicrobial peptide and an application of the antimicrobial peptide. Background technique [0002] Antimicrobial peptide is a general term for short peptides with antibacterial properties. In 1981, Swedish scientist Steiner et al. isolated a bactericidal peptide from the pupa of Hyatophora cecropia and named it cecropin. So far, it has been found that antimicrobial peptides and small molecular short peptides similar to antimicrobial peptides widely exist in the biological world, including bacteria, animals, plants and humans. This endogenous antimicrobial peptide is induced and synthesized, which plays an important role in the body's resistance to the invasion of pathogens. Antimicrobial peptides have a broad-spectrum bactericidal effect, most of them have a relatively killing effect on Gram-positive bacte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/17A61P31/04C07K14/435C12N1/21C12N15/12C12N15/63
Inventor 殷志新何建国颜江辉何薇
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com