Colloidal gold immunochromatography test paper card for detecting African swine fever virus antibody
A technology of African swine fever virus and immunochromatographic test paper, which is applied in the field of immune detection, and achieves the effects of easy promotion and use, high practical value, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: the preparation of recombinant antigen of the present invention
[0035] 1. Preparation of recombinant expression strain of African swine fever virus capsid protein P72 trimer
[0036] Based on the analysis of bioinformatics and structural biology methods, the present invention redesigns the African swine fever capsid protein P72, and synthesizes the p72 (strep-tag) gene sequence of the African swine fever virus by a chemical synthesis method. The p72 gene, yeast GAL1 promoter and ADH1 terminator were constructed on the plasmid to form the P72 protein gene expression cassette. The P72 protein gene expression cassette with homologous recombination arms was amplified by PCR as a repair template. Using CRISPR-Cas9 technology, the gRNA that recognizes GGATTTAGGAATCCATAAAA was co-expressed, and the P72 protein gene expression cassette was inserted into the multi-copy Ty2 retrotransposon of Saccharomyces cerevisiae through homologous recombination to achieve mu...
Embodiment 2
[0049] Embodiment 2: Colloidal gold immunochromatography detection test paper card for preparing African swine fever virus antibody
[0050] 1. Preparation of gold-labeled conjugates of African swine fever virus capsid protein P72 monomer labeled with gold particles by electrostatic adsorption
[0051] Take 40nm colloidal gold particles and adjust the pH to 7.5 with 0.1 mol / L NaOH solution, add 10ug African swine fever virus capsid protein P72 monomer, mix quickly and mix well at room temperature on a 3D rotator for 30min, then add a final concentration of 1% BSA And mix on a 3D rotary mixer for 30 minutes, centrifuge the gold standard solution at 12000 r / min at 4 °C for 10 minutes, carefully discard the supernatant, wash the precipitate twice with 0.01mol / L PBS buffer, and centrifuge again. The precipitate is the purified gold-labeled complex. The prepared colloidal gold-labeled African swine fever virus capsid protein P72 monomer is resuspended in 0.01mol / L PBS and stored at...
Embodiment 3
[0058] Embodiment 3: colloidal gold immunochromatography test paper card specificity test
[0059] Cross-test the known porcine circovirus antibody-positive serum, porcine blue ear virus antibody-positive serum, porcine pseudorabies virus antibody-positive serum, swine fever virus antibody-positive serum and African swine fever virus antibody-positive serum, the results are shown in figure 2 .
[0060] figure 2 The results showed that only the African swine fever virus antibody-positive serum sample had a positive reaction with the detection line, but when it reacted with several other sera, the detection line had no color development and a negative reaction, indicating that the antigen was used to detect African swine fever virus antibodies. Antibodies to CSFV are highly specific.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap