Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of p-benzoquinone and/or p-benzoquinone derivatives in the preparation of anti-novel coronavirus drugs

A coronavirus and p-benzoquinone technology, applied in antiviral agents, resistance to vector-borne diseases, pharmaceutical formulations, etc., to achieve the effect of inhibiting activity and proliferation, and alleviating immune imbalance

Active Publication Date: 2022-07-05
SHANDONG DYNE MARINE BIOTECHCAL PHARM HLDG CO LTD +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the prior art, there is no report that benzoquinones are used for anti-new coronavirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of p-benzoquinone and/or p-benzoquinone derivatives in the preparation of anti-novel coronavirus drugs
  • Application of p-benzoquinone and/or p-benzoquinone derivatives in the preparation of anti-novel coronavirus drugs
  • Application of p-benzoquinone and/or p-benzoquinone derivatives in the preparation of anti-novel coronavirus drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Expression and purification of novel coronavirus 3CLPro protein

[0035] 1.1 Primer Design

[0036]Gene-specific primers (3CL-F: gtgccgcgcggcagccatatgtcggcagtgctgcaaagcggtttccgtaagatg, SEQ ID NO: 1; 3CL-R: gtggtggtggtggtgctcgaggggcccttgaaaggtcacacaccgcgcgcgcgcgcttgaaaggtcacac) were designed according to the gene of novel coronavirus 3CLPro (protein residues 3264-3569 of ORF1ab, GenBank accession number: MN908947.3). , SEQ ID NO: 2), wherein the 3CLPro-F primer sequence has an NdeI restriction site, and the 3CLPro-R primer sequence has an XhoI restriction site. Add 5 amino acids of SAVLQ to the N-terminus of the protein to construct a 3CLPro self-enzyme cleavage site; add two amino acids of GP after the VTFQ amino acid of the C-terminus of the protein to construct a Precision protease cleavage site to promote the fusion expression of the target gene and the His tag.

[0037] 1.2 Amplification of novel coronavirus 3CLPro gene

[0038] The novel coronavirus 3CLPro gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the application of p-benzoquinone and / or p-benzoquinone derivatives in the preparation of anti-novel coronavirus drugs, and belongs to the technical field of biomedicine. p-benzoquinone and / or p-benzoquinone derivatives can inhibit the 3C-like protease (3CLP) and / or papain-like cysteine ​​protease (PLP) activity of the novel coronavirus, thereby inhibiting the novel coronavirus The activity and proliferation of the virus can alleviate the immune imbalance in the infected host cells, thereby achieving the effect of treating the new coronavirus.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to the application of p-benzoquinone and / or p-benzoquinone derivatives in the preparation of anti-novel coronavirus drugs. Background technique [0002] Quinone compounds are a class of chemical components with a quinoid structure, and are mainly divided into four types: benzoquinone, naphthoquinone, phenanthrenequinone and anthraquinone. Benzoquinones are divided into two categories: o-benzoquinone and p-benzoquinone. The structure of o-benzoquinone is unstable, so most of the naturally occurring benzoquinone compounds are derivatives of p-benzoquinone. [0003] Various biological activities of benzoquinone compounds are disclosed in the prior art. For example, the widely existing ubiquinone (coenzyme Q) is a derivative of p-benzoquinone, which participates in redox reactions in vivo, wherein coenzyme Q10 can be used for the treatment of hypertension, Heart disease and cancer....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/122A61K31/277A61P31/14
CPCA61K31/122A61K31/277A61P31/14Y02A50/30
Inventor 颜世强杨杰何淑旺王文笙程中伟胡醒
Owner SHANDONG DYNE MARINE BIOTECHCAL PHARM HLDG CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More