Supercharge Your Innovation With Domain-Expert AI Agents!

A myocardial ischemia-reperfusion injury marker circRNA and its application

A technology for reperfusion injury and myocardial ischemia, which is applied in the direction of DNA/RNA fragments, applications, cardiovascular system diseases, etc., can solve problems such as the complex mechanism of myocardial ischemia-reperfusion injury, and achieve the reduction of myocardial apoptosis and the reduction of infarct size. zoom out effect

Active Publication Date: 2022-08-02
SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In general, the mechanism of myocardial ischemia-reperfusion injury is complex, and there are many intervention targets and measures. So far, there are few relatively simple and effective intervention measures applied to the prevention and treatment of clinical myocardial ischemia-reperfusion injury.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A myocardial ischemia-reperfusion injury marker circRNA and its application
  • A myocardial ischemia-reperfusion injury marker circRNA and its application
  • A myocardial ischemia-reperfusion injury marker circRNA and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The present invention adopts the method of bioinformatics and uses TargetScan and miRanda database analysis to predict 10 circRNAs that are most likely to form a sponge adsorption relationship with miRNA-146a. The circRNA information is shown in Table 1.

[0033] Table 1 CircRNAs predicted by TargetScan and miRanda database

[0034]

[0035] The corresponding primers were designed according to the predicted results, and a mouse myocardial ischemia-reperfusion (reperfusion 1 hour) model and a sham operation model (sham) were established to verify the expression of these 10 circRNAs in myocardial tissue respectively.

[0036] It was found that the expression level of mmu_circ_0001346 was significantly increased after 1 hour of ischemia-reperfusion (see figure 1 ), which is consistent with the time point of decreased miRNA-146a expression (results in figure 2 , the experimental method is qPCR; the upstream primer is: AGCTGAGGAGCGACAGAAAGTT (SEQ ID NO. 8); the downstr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a myocardial ischemia-reperfusion injury marker circRNA and an application thereof, and belongs to the field of biotechnology. The present invention proves that circ-Fbxl5 can form a sponge adsorption relationship with miRNA-146a in cardiomyocytes to relieve the protective effect of miRNA-146a on myocardial ischemia-reperfusion injury, and designs a shRNA that can knock down the expression of circ-Fbxl5 . After testing, the shRNA prepared by the present invention can knock down the expression of circ-Fbxl5, and can significantly reduce the infarct size and the level of myocardial apoptosis in myocardial ischemia-reperfusion mice, which proves that the shRNA prepared by the present invention can be used for preventing and treating myocardial ischemia. Drugs for reperfusion injury are applied.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a myocardial ischemia-reperfusion injury marker circRNA and an application thereof. Background technique [0002] Coronary heart disease is a major disease that seriously endangers human health and life. About 1.8 million patients worldwide die of this disease every year. Acute myocardial infarction (MI), as a serious type of coronary heart disease, is the main cause of death and disability of coronary heart disease. Timely and effective opening of culprit vessels and restoration of myocardial perfusion are the main measures to save patients' lives and improve their quality of life, that is, myocardial ischemia reperfusion (IR) therapy. However, as early as 1985, Braunwald pointed out that ischemia-reperfusion is actually a double-edged sword. Although the diseased blood vessels are opened and the dying myocardium is rescued, the free radicals and calcium overload generated during ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12N15/113C12N15/864A61K31/7088A61P9/10
CPCC12Q1/6883C12N15/113C12N15/86A61P9/10C12Q2600/158C12Q2600/178C12Q2600/136C12N2310/14C12N2750/14143C12N2800/107C12N2310/531
Inventor 王长谦李冬九毛承誉由佳音
Owner SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More