Oocyte function recovery preparation for TRIP13 gene mutation induced oocyte maturation defect and use method of oocyte function recovery preparation
A preparation and egg technology, applied in the field of egg function recovery preparations for egg maturation disorders
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment
[0032] Example: Ovum function recovery of patient A with ovum maturation disorder
[0033] (1) preparation preparation:
[0034] The TRIP13 gene cDNA was used as a template to amplify the coding region of TRIP13 (including the stop codon) by PCR, and the PCR product was purified and used as a template to construct the vector pCMV6 after double digestion with SfaAI and MluI, and the vector was single-digested with AgeI. Transcribed into cRNA of TRIP13 in vitro, and diluted its concentration to 500ng / ul;
[0035] TRIP13cRNA preparation prepares PCR amplification primer pair as follows:
[0036] hTRIP13-SfaAI-F: GAGGCGATCGCATGGACGAGGCCGTGGGCGAC
[0037] hTRIP13-TGA-MluI-R: GCGACGCGTTCAGATGTAAGCTGCAAGCTTCT;
[0038] (2) How to use:
[0039] The patient with egg maturation disorder came from the reproductive center of a university affiliated hospital in Shanghai, China; the female patient’s female reproductive organs, ovarian function, sex hormones, and ovulation were all normal;...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com