Detection of modified live swine influenza virus vaccines
A technology of swine influenza virus and influenza virus, applied in the field of detection of modified live swine influenza virus vaccine, can solve the problems of undisclosed and undisclosed specific oligonucleotide probes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0535] The following examples are intended to illustrate the invention only. These examples should not limit the scope of the claims in any way.
[0536] Materials and methods
[0537] 1. Preparation of Primer / Probe Mixture
[0538] Table 1: Primer / Probe Sequences:
[0539]
[0540] Table 2: Primer / Probe Concentrations
[0541] Primer / Probe Mix Final concentration: NSfor gataataggctctctttgtg (SEQ ID NO: 1) 0.5μM NSrev aggtaatggtgaaatttctc (SEQ ID NO:2) 0.4μM WTfluprobe gtgtgatctttaaccgattatagagactttg (SEQ ID NO: 11) 0.25μM MLVfluprobe1 atggaaaagtagatcttgattaattaagagg (SEQ ID NO: 7) 0.25μM MLVfluprobe2 agtagatcttgattaattaagagggagc (SEQ ID NO: 5) 0.25μM
[0542] Primers and probes were purchased from Biosearch Technologies.
[0543] NS (nonstructural protein); for (forward); rev (reverse); WT (wild type); MLV (modified live virus)
[0544] 2. Preparation of Master Mix
[0545] Table 3: Preparation of master ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap