Detection of modified live swine influenza virus vaccines

A technology of swine influenza virus and influenza virus, applied in the field of detection of modified live swine influenza virus vaccine, can solve the problems of undisclosed and undisclosed specific oligonucleotide probes

Pending Publication Date: 2020-09-04
BOEHRINGER INGELHEIM VETMEDICA GMBH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, none of the documents disclose a method for determining the proper vaccination of animals or a method that allows the distinction between animals infected with SIV and those vaccinated with a modified live swine influenza specific vaccine
Further, none of the documents disclose specific oligonucleotide probes for modified live swine influenza specific vaccines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection of modified live swine influenza virus vaccines
  • Detection of modified live swine influenza virus vaccines
  • Detection of modified live swine influenza virus vaccines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0535] The following examples are intended to illustrate the invention only. These examples should not limit the scope of the claims in any way.

[0536] Materials and methods

[0537] 1. Preparation of Primer / Probe Mixture

[0538] Table 1: Primer / Probe Sequences:

[0539]

[0540] Table 2: Primer / Probe Concentrations

[0541] Primer / Probe Mix Final concentration: NSfor gataataggctctctttgtg (SEQ ID NO: 1) 0.5μM NSrev aggtaatggtgaaatttctc (SEQ ID NO:2) 0.4μM WTfluprobe gtgtgatctttaaccgattatagagactttg (SEQ ID NO: 11) 0.25μM MLVfluprobe1 atggaaaagtagatcttgattaattaagagg (SEQ ID NO: 7) 0.25μM MLVfluprobe2 agtagatcttgattaattaagagggagc (SEQ ID NO: 5) 0.25μM

[0542] Primers and probes were purchased from Biosearch Technologies.

[0543] NS (nonstructural protein); for (forward); rev (reverse); WT (wild type); MLV (modified live virus)

[0544] 2. Preparation of Master Mix

[0545] Table 3: Preparation of master ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates i.a. to diagnostic kits and methods for detecting an animal vaccinated with a modified live Swine Influenza virus specific vaccine and diagnostic kits and methods for differentiating animals vaccinated with a modified live Swine Influenza virus specific vaccine from animals infected with Swine Influenza virus, respectively.

Description

[0001] This application contains a Sequence Listing pursuant to 37 C.F.R. 1.821-1.825. The Sequence Listing accompanying this application is hereby incorporated by reference in its entirety. [0002] Background of the invention [0003] Influenza infection of swine was first reported in 1918, and the first swine influenza virus was isolated from pigs in 1930 (Shope, R.E., 1931, J. Exp. Med. 54:373-385). Swine influenza (SI) is an acute respiratory disease of pigs caused by influenza A and C viruses. Its severity depends on many factors, including host age, virus strain, and secondary infection (Easterday, 1980, Philos Trans R Soc Lond B Biol Sci 288:433-7). Prior to 1998, the "classic" H1N1 SI virus (SIV) was mainly isolated from pigs in the United States (Kida et al., 1994, J Gen Virol 75:2183-8; Scholtissek, 1994, Eur J Epidemiol 10:455-8 ; Olsen et al., 2000, Arch Virol. 145:1399-419). In 1998, the H3N2 subtype of SIV was isolated in several states in the United States. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70
CPCC12Q1/702C12Q1/6888C12Q1/701
Inventor P·莫劳-布拉泽耶夫斯卡K·D·杜利特尔
Owner BOEHRINGER INGELHEIM VETMEDICA GMBH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap