Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA bar code composition for identifying origin of cordyceps sinensis and application of DNA bar code composition

A Cordyceps sinensis and barcode technology, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, microbial measurement/inspection, etc., can solve the problems of lack of scientific judgment and inability to accurately identify the origin of Cordyceps sinensis, and achieve simple process, high accuracy, and easy operation The effect of simple method

Active Publication Date: 2020-07-24
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, there is no uniform and rigorous standard for how to identify the origin of Cordyceps sinensis. Ordinary consumers and even practitioners in the Chinese medicine industry also lack a reasonable scientific basis for this. Simply relying on traditional experience may not be able to accurately identify Cordyceps sinensis place of origin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA bar code composition for identifying origin of cordyceps sinensis and application of DNA bar code composition
  • DNA bar code composition for identifying origin of cordyceps sinensis and application of DNA bar code composition
  • DNA bar code composition for identifying origin of cordyceps sinensis and application of DNA bar code composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The acquisition of the DNA barcode of the sample to be tested in embodiment 1

[0039] The applicant selected Cordyceps sinensis marked as Xiaojin County, Sichuan Province, and obtained its DNA barcode sequence according to the following method.

[0040] 1) separating and extracting the DNA of the body part of Cordyceps sinensis from the sample to be tested;

[0041] 2) Using the total DNA extracted in step 1) as a template, use LCO-1490 and HCO-2198 to perform PCR amplification to obtain an amplification product;

[0042] 3) Sequencing the product amplified in step 2);

[0043] Wherein, the universal primer pair of DNA barcode sequence is:

[0044] LCO-1490: GGTCAACAAATCATAAAGATATTGG

[0045] HCO-2198: TAAACTTCAGGGTGACCAAAAAAATCA

[0046] The kit used in the test of the present invention in step 1) is Qiagen Blood & Tissue Kit (Cat. No. 69506), and the specific operation refers to the kit instruction page;

[0047] In step 2), use the obtained DNA template to perf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DNA bar code composition for identifying the origin of cordyceps sinensis. The DNA bar code composition is a fragment of a CO1 gene representing different origins of cordycepssinensis. The invention provides the application of the DNA bar code composition and the amplification primer thereof in identifying the origin of cordyceps sinensis. The invention further provides amethod for identifying the origin of the cordyceps sinensis. Based on the characteristics that the migration capacity of cordyceps sinensis host bat Hepialus armoricanus larvae is weak and the distribution place is only limited to a high-altitude area in China, a set of simple, rapid and easy-to-operate method for identifying the cordyceps sinensis origin is established.

Description

technical field [0001] The invention belongs to the field of detection of traditional Chinese medicines, in particular to a DNA barcode composition for identifying the origin of Cordyceps sinensis. The present invention also relates to a primer for amplifying the DNA barcode composition, a method and a kit for identifying the origin of Cordyceps sinensis. Background technique [0002] Cordyceps sinensis (Ophiocordyceps sinensis Berk.Sacc.) is a precious traditional Chinese herbal medicine in my country. Its nourishing effect and nutritional value are highly sought after by people. In recent years, the market price has also increased year by year. system, endocrine system and circulatory system, anti-cancer, anti-oxidation, delaying human aging, etc. Cordyceps sinensis is formed by connecting the larvae of bat moths (Lepidoptera Lepidoptera Hepialidae Hepialidae Hepiaua) and the fungal sporosomes growing from their heads. It is mainly distributed in my country's Tibet, Qingha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6869C12Q1/04C12N15/11
CPCC12Q1/6869C12Q1/6895C12Q2531/113C12Q2537/165C12Q2535/122
Inventor 李逸秦启联朱朝东周桂灵张继红张寰王红托李瑄
Owner INST OF ZOOLOGY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More