Method for improving resistance of formic acid and acetic acid in cellulose hydrolysate by utilizing formic acid dehydrogenase
A cellulose hydrolyzate and formate dehydrogenase technology, which is applied in the field of bioengineering to achieve the effects of cost saving, improving resistance and improving formate dehydrogenase activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1: Construction of bacterial strain S.cerevisiae-FDH
[0024] 1) Using the genome of Saccharomyces cerevisiae model strain S288C as a template for PCR amplification to obtain the Fdh gene fragment, the nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively:
[0025] Upstream primer: attg cggccgct atgtcgaagggaaaggttttg (SEQ ID NO. 1)
[0026] Downstream primer: acgcgc gtcgac ttatttcttctgtccataag (SEQ ID NO.2)
[0027] The kit used for PCR amplification is HS DNA Polymerase (Code No.: R010A) was purchased from Treasure Bioengineering (Dalian) Co., Ltd., and the PCR reaction was carried out according to the instructions of the kit.
[0028] The PCR amplification conditions are: 98°C pre-denaturation for 5 minutes; 98°C for 15s, 55°C for 15s, 72°C for 60s, 30 cycles; 72°C for 7min;
[0029] 2) The obtained Fdh gene fragment was double-digested with restriction endonucleases Not I and Sal I, and th...
Embodiment 2
[0034] Embodiment 2: adopt two-step method to ferment cellulose raw material to produce xylitol and ethanol, the investigation of the growth situation on the plate containing formic acid and acetic acid
[0035] 1) Preparation of activation medium: activation medium: YNB 6.7g / L, glucose 10g / L, amino acid supplement solution without Trp.
[0036] 2) Activation of the strains: the strain S. cerevisiae-FDH prepared in Example 1 and the original strain S. cerevisiae S288C stored in the refrigerator were inoculated into the activation medium, placed in a shaker at 30° C., and cultured at 150 rpm for 24 hours.
[0037] 3) Preparation of seed medium: seed medium: YNB 6.7g / L, glucose 20g / L, amino acid supplement solution without Trp.
[0038] 4) The activated bacteria in step 2) were transferred to the seed medium prepared in step 3), and placed in a shaker at 30° C., 150 rpm for 24 hours.
[0039] 5) Preparation of differential medium: differential medium: YNB 6.7g / L, glucose 20g / L,...
Embodiment 3
[0042] Example 3: Fermentation in liquid medium containing acetic acid
[0043] 1) Activation medium: YNB 6.7g / L, glucose 10g / L, amino acid supplement solution without Trp.
[0044] 2) The strain S.cerevisiae-FDH prepared in Example 1 and the original strain stored in the refrigerator were inoculated into the activation medium, placed in a shaker at 30° C., and cultured at 150 rpm for 24 hours.
[0045] 3) Preparation of seed medium: seed medium: YNB 6.7g / L, glucose 20g / L, amino acid supplement solution without Trp.
[0046] 4) Take the activated bacteria and transfer them to the seed medium prepared in step 3), place them in a shaker at 30° C., and cultivate them at 150 rpm for 24h-48h.
[0047] 5) Preparation of fermentation medium: fermentation medium: YNB 6.7g / L, glucose 40g / L, Trp-free amino acid supplement solution, acetic acid 4g / L.
[0048] 6) After the strains are activated and the seeds are expanded and cultivated, the cells are collected by centrifugation, and the...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com