Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for hydrolyzing zearalenone and derivatives thereof

A technology of zearalenone and zearalenol, which is applied in the field of hydrolysis of zearalenone and its derivatives, can solve the problems of low relative activity and achieve high relative activity, excellent thermal stability, stable good sex effect

Active Publication Date: 2020-02-21
HUBEI UNIV
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these zearalenone-degrading enzymes only have high activity on zearalenone (ZEN), and low relative activity on its derivatives zearalenol (ZOL) and zearalenol (ZAL). , are not very suitable for large-scale industrial applications, and it is necessary to obtain a degrading enzyme that can overcome these disadvantages and is suitable for large-scale industrial applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for hydrolyzing zearalenone and derivatives thereof
  • Method for hydrolyzing zearalenone and derivatives thereof
  • Method for hydrolyzing zearalenone and derivatives thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Preparation and Purification of Zearalenone Degrading Enzyme

[0035] (1) Artificial synthesis of gene sequence

[0036] Entrusted Wuhan Jinkairui Bioengineering Co., Ltd. to synthesize the nucleotide sequence shown in SEQ ID NO: 3, and insert the sequence into the plasmid vector pET28a, and save it for future use.

[0037] The sequence of SEQ ID NO:3 is as follows:

[0038] atgccagctcagagaaccagatccaccgttagaactaacgacggtatcacctggtactacgagcaagaaggttctggtccagacatcgttttgatcccagatggtgttggtgactgcggtttgttcgatcagccaatgtctactattgcctcctccggtttcagagttaccactttcgatatgccaggtatgtccagatctgctgctactgctccaccagaaacttaccaagacgttaccggtcaaaagctggccggttacatcgttactttgatggacgagttgggtatcaagtccgctgctgtttggggttgttcttctggtgctactactgttttggccctgtgttctggtttcccagacagagttagaaacggtatgccacacgaggttccaactgttaacccagacaacctgaagaacatccacgaggttactgacactgacgctttgactgctgaattggctgctaccatcagaactatgtctgctaacgaagctgcttgggatgctttgggtgctgaagttcacgaaagactgagaggtaactacgctagatgggcttacggttacccaagaactattccaggttccgc...

Embodiment 2

[0062] Example 2 Using zearalenone as a substrate to verify the function of zearalenone-degrading enzymes

[0063] The enzyme activity unit is defined as the amount of enzyme required to degrade 1 μg of the substrate zearalenone within 1 min as an enzyme activity unit U.

[0064] (1) Optimum temperature

[0065] The Zhd11B pure enzyme solution in Step 5 of Example 1 was diluted with 50 mM Tris-HCl buffer solution of pH 8.0, and the enzyme activity was measured with the diluted enzyme solution. The diluted enzyme solution was recorded as the diluted enzyme solution.

[0066] The composition of solution A: consists of 50 mM Tris-HCl buffer solution with pH 8.0 and zearalenone solution; the final concentration of the substrate zearalenone in the reaction system 0.5 mL is 10.0 μg / ml.

[0067] Experimental group: The reaction system for activity determination is 0.5mL, diluted with 0.45mL solution A and 0.05mL enzyme solution; the pH value of the reaction system is 8.0; mL of ch...

Embodiment 3

[0090] Example 3 Zearalenone degrading enzyme Zhd11B point mutation

[0091] The 158th position of the zearalenone degrading enzyme Zhd11B of the amino acid sequence shown in SEQ ID NO: 1 is mutated from threonine to histidine to obtain the zearalenone degrading enzyme Zhd11B (T158H), after the point mutation The amino acid sequence of zearalenone degrading enzyme Zhd11B (T158H) is shown in SEQ ID NO:2, and the nucleotide sequence of the coding gene is shown in SEQ ID NO:4. in,

[0092] SEQ ID NO:2

[0093] Met Pro Ala Gln Arg ThrArg Ser Thr Val Arg Thr Asn Asp Gly Ile ThrTrp Tyr Tyr Glu Gln Glu Gly Ser Gly Pro Asp Ile Val Leu Ile Pro Asp Gly ValGlyAsp Cys Gly Leu Phe Asp Gln Pro Met Ser Thr Ile Ala Ser Ser Gly Phe ArgVal Thr Thr Phe Asp Met Pro Gly Met SerArg SerAlaAla ThrAla Pro Pro Glu ThrTyr GlnAsp Val Thr Gly Gln Lys Leu Ala Gly Tyr Ile Val Thr Leu Met Asp GluLeu Gly Ile Lys Ser Ala Ala Val Trp Gly Cys Ser Ser Gly Ala Thr Thr ValLeuAla Leu Cys Ser Gly Phe Pro Asp Arg V...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a method for hydrolyzing zearalenone and derivatives thereof. The zearalenone or derivatives thereof is used as a substrate, the substrate is hydrolyzed by using a zearalenone degrading enzyme and an amino acid sequence of the zearalenone degrading enzyme is shown in SEQ ID NO:1 or SEQ ID NO:2. The zearalenone degrading enzyme has high enzyme activity, good temperature and pH tolerance, etc., can be widely used in enzymatic hydrolysis of the zearalenone and several derivatives thereof, has a wide range of substrates, and has relatively high activity against zearalenone, alpha-zeranol and beta-zeranol, the amino acid sequence shown in the SEQ ID NO:2 is obtained by mutating the 158th T of the amino acid sequence shown in the SEQ ID NO:1 to H, and enzyme activity of the substrate alpha-zeranol is increased by 40% after the mutation.

Description

technical field [0001] The invention relates to the field of biological technology, in particular to the application of a zearalenone degrading enzyme in hydrolyzing zearalenone and its derivatives and a method for hydrolyzing zearalenone and its derivatives. Background technique [0002] Zearalenone, first isolated from corn, is a non-steroidal estrogenic mycotoxin that can be produced by many Fusarium species, both before and after harvest. Zearalenone is consistently found in many crop and cereal by-products including corn, barley, wheat, etc., especially in environments that are suitable for fungal growth. [0003] There are many derivatives of zearalenone, such as zearalenol, which will enter the food chain through contaminated crops and accumulate in human and animal bodies, causing damage to organisms. The chemical structure of zearalenone and its derivatives is similar to natural estrogen, so they can competitively bind to estrogen receptors, causing external and in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/16C12N15/55A23L5/20
CPCC12N9/16A23L5/25
Inventor 张桂敏江天知王美星马延和
Owner HUBEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com