Method for Improving Color Sorting Accuracy of Rice Genetic Engineering Male Sterile Line Seeds by Utilizing Dominant Black Glue Trait
A genetic engineering and nuclear sterile line technology, applied in the field of rice genetic engineering nuclear sterile line seed color sorting accuracy, can solve the problem of reducing the intensity of fluorescent proteins, hindering the promotion and application of third-generation hybrid rice, and interfering with the color sorting of color sorters Accuracy and other issues, to achieve the effect of solving insufficient color sorting accuracy, improving purity, and ensuring purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] A method for improving the color-sorting accuracy of rice genetically engineered male sterile line seeds by utilizing the dominant black chaff trait, the procedure can be found in figure 1 , including the following steps:
[0051] (1) Cultivation of Huangying double-color selection genetically engineered male sterile line with PTC1 gene mutation:
[0052] 1.1. Rice PTC1 gene encodes PHD zinc finger protein, which is a key gene regulating tapetum development and pollen formation. Mutations in the PTC1 gene will lead to abortion of rice pollen and produce a genetically engineered male sterile line. According to the cDNA sequence (Seq1) of PTC1 gene, double target sites were designed and target site linker primers Seq2 and Seq3 were synthesized.
[0053] Seq1 (SEQ ID NO.1):
[0054] cgttgattggcagcaactagctagctcgccgtccggccggccggccatggcgcctaagatggtgatcagcctggggagctcgcggcggcggaagcgcggcgagatgctgttccggttcgaggccttctgccagcccggctacccggcgaacttcgccggcgccggcggcttcagggacaacgtgaggacg...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com