Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A strain of recombinant Pichia pastoris, its expression product and its application

A pair of sweet potato technology, applied in the fields of genetic engineering and molecular biology, can solve problems such as environmental pollution, and achieve the effect of strong antibacterial effect

Active Publication Date: 2021-02-26
XUZHOU NORMAL UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chitin oligosaccharide, the degradation product of chitin, is a functional oligosaccharide with unique physiological activity, which has wide application value in various fields such as agriculture, biomedicine, food, cosmetics, etc., but currently the biological resources of chitin The development is mainly based on chemical methods, and almost all of them use strong acid and strong alkali, which causes great pollution to the environment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A strain of recombinant Pichia pastoris, its expression product and its application
  • A strain of recombinant Pichia pastoris, its expression product and its application
  • A strain of recombinant Pichia pastoris, its expression product and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] (1) Primer design

[0018] The following pair of primers were designed and synthesized according to the sequence (SEQ ID No.1) of the IbChiA gene:

[0019] FW: 5’—CCGGAATTCATGAGTGTGGGGTCCATTGT—3’

[0020] REV: 5'—CGGGGTACCGTGGAGCCAAAAGGCCT—3'

[0021] The two ends of FW and REV are designed with EcoR I and Kpn I restriction sites respectively.

[0022] (2) PCR amplification of IbChiA gene

[0023] Use Phusion ultra-fidelity PCR Master Mix (New England BaiLabs), FW, REV primers, use the T plasmid containing IbChiA as a template, and the PCR reaction system is 25ul:

[0024]

[0025]

[0026] The reaction conditions are: 98°C for 3min; 98°C for 30s; 58°C for 30s; 72°C for 50s; 72°C for 10min; cycle 34 times;

[0027] (3) The target gene is connected to the Pichia pastoris expression vector pPICZα

[0028] like figure 1 As shown, the PCR product of IbChiA and pPICZα were double digested with restriction endonucleases EcoRI and Kpn I, and then the target fragmen...

Embodiment 2

[0029] Example 2 Secretion and expression of recombinant vector pPICZα+IbChiA electrotransformed into Pichia pastoris X-33

[0030] (1) Preparation of Pichia pastoris X-33 (purchased by Invitrogen) electroporation competent cells and their electroporation transformation

[0031] S11. Pick a fresh single colony and put it in 5ml YPD liquid medium, cultivate it at 30°C and 250rpm for 12-14 hours;

[0032] S12. Inoculate 0.1% inoculum into a 2L Erlenmeyer flask containing 500ml of YPD medium, and cultivate at 30°C and 250rpm for 12-14 hours to make OD600=1.3-1.5;

[0033] S13. Centrifuge at 1500 rpm for 5 minutes at 4°C to collect the cells;

[0034] S14. Wash the cells twice with 500-250ml ice-cold sterile water;

[0035] S15. Wash the cells once with 20 ml of ice-cold 1M sorbitol solution;

[0036] S16. Resuspend the cells with 1ml of ice-cold 1M sorbitol solution to a final volume of about 1.5ml, and dispense 80μl into small centrifuge tubes.

[0037] (2) Electric shock tr...

Embodiment 3

[0064] Antibacterial activity experiment of embodiment 3 purpose sweet potato chitinase

[0065] Use sweet potato black spot fungus and root rot fungus as the test strains, configure PDA medium, inoculate the fungus cakes of sweet potato black spot fungus and sweet potato root rot fungus, and place the Oxford cup evenly at the center of the distance when the hyphae grow to a radius of 1cm At a radius of 2.5cm, add 100ul pPICZα+IbChiA-X33 fermentation broth supernatant to each Oxford cup, distilled water as a control, continue to cultivate, observe the antibacterial activity of the chitinase, the results are as follows Figure 4 As shown, wherein, A: black spot bacterium; B: root rot bacterium; 0: distilled water; 1, 2, 3: fermentation supernatant of IbChiA, it can be seen that the sweet potato chitinase has obvious inhibitory effect on two kinds of pathogens , which laid the foundation for its application in inhibiting plant pathogenic fungi.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides recombinant pichia pastoris and an expression product and application thereof. A clonal sweet potato chitinase gene IbChiA is utilized to be operably connected with an expression carrier to obtain a recombinant expression carrier capable of expressing the protein; the recombinant expression carrier is imported into right host cells to obtain a genetically engineered bacterium for expressing the IbChiA. The invention further provides a method for preparing the IbChiA. The method comprises the step that by culturing pPICZalpha and IbChiA-X33, the chitinase IbChiA is obtained through inducible expression, wherein according to the induction conditions, an inducer methyl alcohol is supplemented one time every 24 hours until the final concentration of the methyl alcohol is1.0%. The invention further provides the application of the sweet potato chitinase in hydrolyzing colloidal chitin and inhibiting plant pathogenic fungi. The sweet potato chitinase prepared in the method has high inhibiting effects on ophiostoma fimbriatum and root rot fungi; according the method for the recombinant pichia pastoris to express the sweet potato chitinase, the extracellular secretion volume can reach 403 mg / L, and with the colloidal chitin as a substrate, the enzyme activity reaches 20 U / ml.

Description

technical field [0001] The invention relates to the fields of molecular biology and genetic engineering, in particular to a strain of recombinant Pichia pastoris, its expression product and its application. Background technique [0002] Chitin is widely distributed in animals and microorganisms, and is the second largest renewable resource after cellulose, with an annual biosynthesis capacity of 10 billion tons. Chitin oligosaccharide, the degradation product of chitin, is a functional oligosaccharide with unique physiological activity, which has wide application value in various fields such as agriculture, biomedicine, food, cosmetics, etc., but currently the biological resources of chitin The development of these methods is mainly based on chemical methods, almost all of which use strong acids and strong alkalis, causing great pollution to the environment. The use of chitinase to hydrolyze chitin to prepare chitooligosaccharides has the advantages of mild and controllable...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/19C12N15/81C12N15/56C12N9/42A01N63/32A01P3/00C12R1/84
CPCA01N63/00C12N9/2442C12N15/815C12Y302/01014
Inventor 刘美艳宫颖黄金金张健骆凤张倩陈一虹钱琳娜
Owner XUZHOU NORMAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More