Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetic group for molecular subtyping of medulloblastoma and use of SNCA gene as biomarker of 4-type medulloblastoma

A technique for molecular typing of medulloblastoma, applied in the new application field of SNCA gene, can solve the problem of not further providing potential molecular targets for gene targeted therapy, limiting the application prospects of molecular markers, lack of high specificity and high sensitivity Diagnostic markers and other issues

Active Publication Date: 2018-11-02
常青
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method still has certain limitations: the gene combination is limited to diagnostically distinguishing the 4 molecular subtypes in MB, but it does not provide further information on potential molecular targets for gene-targeted therapy and judgment of patient prognosis; At the same time, the molecular markers provided by this combination are only based on the RNA level, but not verified by the protein level, thus limiting the application prospects of related molecular markers in conventional immunohistochemical methods
[0007] In addition, for type 4 MB, which accounts for the largest proportion of the affected population, there is still a lack of diagnostic markers with high specificity and high sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic group for molecular subtyping of medulloblastoma and use of SNCA gene as biomarker of 4-type medulloblastoma
  • Genetic group for molecular subtyping of medulloblastoma and use of SNCA gene as biomarker of 4-type medulloblastoma
  • Genetic group for molecular subtyping of medulloblastoma and use of SNCA gene as biomarker of 4-type medulloblastoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Classification of Medulloblastoma and Screening of Related Marker Genes of Specific Subtypes

[0063] The FFPE samples of 12 medulloblastoma patients were randomly obtained, and the RNA was extracted with a commercially available kit and the RNA concentration was determined.

[0064] Using the nanoString nCounter technology platform (internal standard genes are CLTC, GAPDH and TUBB), the extracted RNA was detected for the following genes:

[0065] Table 3. Candidate genes

[0066]

[0067]

[0068] Select 12 genes (3 for each subtype) from the 22 recognized molecular subtype-specific genes, and conduct preliminary judgment of MB molecular subtype by Nanostring detection. On this basis, further detect the above 89 genes in MB. The expression of MB molecular subtypes is screened out, and the genes related to MB molecular subtypes that may become molecular therapeutic targets are selected, and other technical methods (DNA next-generation sequencing, gen...

Embodiment 2

[0069] Example 2 NanoString typing and immunohistochemical staining of formaldehyde-fixed paraffin-embedded samples

[0070] Using the 11 tumor-associated genes screened in Example 1 and the known 22 genes associated with MB molecular subtypes (WIF1, TNC, GAD1, DKK2, EMX2, PDLIM3, EYA1, HHIP, ATOH1, SFRP1, IMPG2, GABRA5, EGFL11, NRL, MAB21L2, NPR3, KCNA1, EOMES, KHDRBS2, RBM24, UNC5D, OAS1) constitute a gene group of 33 genes, and the gene group of 22 genes is known to carry out MB sample analysis based on the Nano-String nCounter analysis platform For type comparison, the nanoString nCounter detection probes for each gene are shown in Table 2 above.

[0071] Formaldehyde-fixed paraffin-embedded samples (FFPE samples) were obtained from 106 medulloblastoma (MB) patients from the Third Hospital of Peking University, Beijing Tiantan Hospital, Beijing Sanbo Brain Hospital, and Anhui Provincial Hospital. Total RNA was extracted from slices of 75 MB samples and analyzed based o...

Embodiment 4

[0093] Example 4 Knockout and overexpression of SNCA in MB cells

[0094] Daoy, D283 and D341 cells (from ATCC) were 4 × 10 4 The cell density was seeded in a 6-well plate, and any one of the three SNCA siRNAs (siRNA1, siRNA2, siRNA3) was transfected into the cells using Chemifect transfection reagent (Feng Rui, China) according to the manufacturer's instructions, with a final concentration of 20μmol / L.

[0095] With GV219 ( Figure 4 4A) in ) is the backbone, and insert the SNCA gene fragment through the restriction site XhoI / KpnI using conventional methods in the art to construct the plasmid GV219-SNCA-wt. The constructed GV219-SNCA-wt was used as a template, and the following sequences were used as forward primer and reverse primer respectively for amplification:

[0096] SEQ-F (769-789bp): CGCAAATGGGCGGTAGGCGTG

[0097] SEQ-R (1101-1121bp): CCCACTGTCCTTTCCTAATAA

[0098] The verified sequence contains the SNCA gene sequence ( Figure 4 The italic part of 4B), whic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic group for molecular subtyping of medulloblastoma. The genetic group is formed on one or more of 32 genes in total. The invention further discloses a kit for molecularsubtyping of medulloblastoma and use of the genetic group in the preparation of a reagent for molecular subtyping of medulloblastoma. Besides, the invention further provides use of an SNCA gene for diagnosis or as a diagnosis marker of 4-type medulloblastoma.

Description

[0001] Cross References to Related Applications [0002] This application claims the benefit of Chinese Patent Application No. 201710260539.4 filed on April 20, 2017, the entire contents of which are hereby incorporated by reference. technical field [0003] The invention belongs to the field of biotechnology, and in particular, the invention relates to a gene group that can be used for molecular typing of medulloblastoma and its use, as well as a new use of the SNCA gene. Background technique [0004] Medulloblastoma (MB) is a common malignant cerebellar embryonal tumor in children. With the deepening of research, it has been found that medulloblastoma is not a single disease, and it is currently recognized that it can be divided into four main molecular subtypes, namely Wnt type (Wnt sungroup), Shh type (Sonic hedgehog subgroup), Shh type (Sonic hedgehog subgroup), Type 3 (type 3) and type 4 (type 4), these molecular subtypes have different characteristics in terms of tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/12
CPCC12Q1/6886C12Q2600/118C12Q2600/156
Inventor 常青
Owner 常青
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com