Oryza sativa floury endosperm related gene OscyMDH, protein encoded by same and application
A protein and gene technology, applied in the field of genetic engineering, can solve problems such as unclear regulation mechanism of rice starch
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1. Discovery of Rice Starch Synthesis Related Sites and Their Encoding Genes
[0041] 1. Starch content distribution analysis and genetic analysis of rice endosperm flour mutant N65
[0042] Among the N22 mutants produced by MNU chemical mutagenesis, an endosperm powdery mutant was screened and named N65.
[0043] Compared with N22, the main feature of N65 is: the starch content in the seeds decreases (see figure 1 ), with an opaque seed phenotype (see figure 2 ). Panel A shows that N22 has translucent endosperm and panel B shows that N65 endosperm is opaque. This indicated that the gene mutation affected the synthesis of starch, resulting in changes in the structure and properties of starch granules, which made the appearance of endosperm significantly different.
[0044] The cross-sections of wild-type and mutant N65 seeds were observed by scanning electron microscopy (see image 3 ), from the magnified 200-fold photo, the starch sheet structure of the cro...
Embodiment 2
[0078] Embodiment 2, the acquisition and identification of transgenic plants
[0079] 1. Construction of recombinant expression vector
[0080] Using the genomic DNA of N22 (from the rice germplasm resource bank of Nanjing Agricultural University) as a template, the OscyMDH gene was obtained by PCR amplification. The PCR primer sequences are as follows:
[0081] primer3:
[0082] 5'CCGGCGCGCCAAGCTTAAGTAATTTGGGAAAGAGG 3' (SEQ ID NO. 6);
[0083] primer4:
[0084] 5'GAATTCCCGGGGATCCTTAGTTGAGGCATGAGTAAG 3' (SEQ ID NO. 7).
[0085] The above primers are located at the upstream 2kb and downstream 1.5kb of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1390 using the INFUSION recombination kit (Takara, Japan). INFUSION recombination reaction system (10 μL): PCR product 1.0 μL, pCAMBIA1305 6.0 μL, 5×infusion buffer 2.0 μL, infusion enzyme...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com