Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A fusion protein of chicken interferon ifn-λ and ifn-α

A chicken interferon and fusion protein technology, applied in the field of bioengineering, can solve the problems of endangering the poultry industry, world economic loss, high mortality, etc., and achieve good anti-virus effect

Active Publication Date: 2020-10-16
SOUTH CHINA AGRI UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disease spreads rapidly and has a high mortality rate, seriously endangering the poultry industry and causing huge losses to the world economy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fusion protein of chicken interferon ifn-λ and ifn-α
  • A fusion protein of chicken interferon ifn-λ and ifn-α
  • A fusion protein of chicken interferon ifn-λ and ifn-α

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Construction of chicken IFN-λ and IFN-α (chIFN-λ+α) fusion gene prokaryotic expression vector

[0042] (1) Design and synthesis of relevant primers

[0043] Primer design is based on the chicken IFN-λ gene sequence (GenBank no.KF680102.1) and IFN-α gene sequence (GenBank no.AM049251.1) provided by Genbank, predicting and removing the signal peptide through SignalP, and designing two pairs of primers , respectively insert EcoR1 and Hind3 two restriction sites in the upstream and downstream, which are IFN-λ-F, IFN-λ-R1, IFN-α-F1, IFN-α-R. Then two primers IFN-λ-R2 and IFN-α-F2 containing complementary hydrophobic flexible amino acid linkers were designed on the downstream of IFN-λ and upstream of IFN-α, respectively. The sequence is as follows:

[0044] IFN-λ-F: CCGGAATTCCAGGTCACCCCCGAAGAA

[0045] IFN-λ-R1: CCCAAGCTTCTAAGTGCAATCCTCGCGCTGGGC

[0046] IFN-λ-R2:

[0047] CTCCGCTACCGCCTCCACCAGAGCTCTCTCCACCAGTGCAATCCTCGCGCTGGGC

[0048] IFN-α-F1: CCGGAATTCTGCA...

Embodiment 2

[0061] Example 2 protein expression and identification

[0062] Transform the recombinant plasmid pET32a-chIFN-λ+α with BL21 competently. After expanding the culture of monoclonal bacteria, inoculate the ampicillin LB medium at a ratio of 1:100, and culture it on a shaker at 37°C until the OD600nm value is about 0.6, then add IPTG After induction of expression, the bacterial solution was centrifuged, the supernatant was discarded, resuspended in PBS, washed by centrifugation twice, lysed by ultrasonic breaker at 200W for 15min, centrifuged at 4°C to separate the precipitate, washed twice with pre-cooled PBS, and washed with Lysis containing 8M urea Equilibration Buffer dissolves inclusion bodies, incubate at room temperature for 60 min, centrifuge at 4°C to remove insoluble impurities, filter the supernatant with a 0.45 μm filter, combine it with a Ni column, and elute with different concentrations of imidazole eluent until the OD280 value is 0, and finally use Elution Buffer ...

Embodiment 3

[0063] Example 3 In vitro antiviral activity identification

[0064] Plate DF-1 cells to 96-well cell plates, wait until they grow to 80%-90%, add 100 μl of chIFN-λ+α to each well in a 4-fold gradient dilution, respectively from 4 -1 -4 -10 ,, 24 replicates for each gradient, incubated at 37°C for 12h, added 100TCID50VSV, NDV, AIV virus respectively, 100μl per well, incubated at 37°C for 1h, discarded the virus solution, washed twice with PBS, and replaced with 2 % serum DMEM, put it at 37°C for 48h, and detect the virus content. The results show that: chIFN-λ+α has a good protective ability on DF-1 cells, and has good VSV, NDV, and AIV antiviral activities on DF-1 cells in vitro, which are 3.2*10 4 IU / mg, 4.6*10 4 IU / mg, 1.5*10 5 IU / mg.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological engineering, and discloses fusion expression of chicken interferon genes lambda and alpha of an interferon fusion preparation, a production method and clinical application thereof. According to the interferon fusion preparation of biological engineering, total RNA (Ribonucleic Acid) of CEF cells is extracted, a specific primer is designed, the chicken interferon genes lambda and alpha are cloned and are fused by using a complementary hydrophobic flexible amino acid connector, and thus the complete chicken interferon fusion genes lambda and alpha can be obtained; the chicken interferon fusion genes lambda and alpha are cloned to a 19-T carrier, is massively cloned and expressed successfully, and is further connected with a pET-32a carrier for massive expression; a product is identified to ensure that the product is expressed in an inclusion body, and then modification, purification and renaturation are implemented; the anti-virus activity of the product is detected, and the clinical application effect of the product is evaluated. Prokaryotic expression plasmid pET32a-chIFN-lambda+alpha of the recombinant chicken interferon genes lambda and alpha is successfully established, and 1:1 fusion expression of the chicken interferon genes lambda and alpha on an escherichia coli prokaryotic expression system can be achieved.

Description

technical field [0001] The invention belongs to the gene fusion expression in the technical field of bioengineering, and in particular relates to a fusion chicken lambda and alpha interferon gene and its preparation method and application. Background technique [0002] Interferon (interferon, IFN) is a kind of cytokine produced by host cells under the action of a specific inducer, which has broad-spectrum anti-virus, anti-tumor and immune-enhancing functions. Its essence is a secreted multifunctional glycoprotein. It was first discovered in 1957 by the British scientist lsaacs when studying the interaction between viruses. Its essence is a protein, induced by viruses, which interferes with virus replication and limits virus infection. According to the source of interferon, amino acid sequence and biological activity, interferon is divided into three categories, namely type I interferon, including IFN-α, IFN-β, IFN-δ, IFN-κ, IFN-ω and IFN -τ, of which IFN-α and IFN-β are rel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/70C12N15/62A61K38/21A61P31/12
CPCA61K38/00C07K14/56C07K14/57C07K2319/00C12N15/70C12N2800/101
Inventor 任涛丁诗月谢鹏
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com