Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Elizabethkingia meningoseptica loop-mediated isothermal DNA amplification rapid detection kit and detection method

A constant-temperature gene amplification and detection kit technology, which is applied in the field of cationofDNA, can solve the problems of complex operation, limitation, and long time consumption, and achieve the effect of low equipment requirements, short detection time, and easy operation

Inactive Publication Date: 2016-11-16
HENAN NORMAL UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional physiological and biochemical identification methods are time-consuming and the reliability of the results is not high; PCR method and real-time fluorescent quantitative PCR method can be used for the detection of pathogenic bacteria, but they require high professional technical level of equipment and personnel, and the operation is complicated and time-consuming Long, which limits the promotion of this technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Elizabethkingia meningoseptica loop-mediated isothermal DNA amplification rapid detection kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Establishment of a rapid detection kit and detection method for ring-mediated constant temperature gene amplification of Elizabeth bacteria meningeseptica

[0030] Step 1, design of primers and assembly of synthetic kits:

[0031] The primer sequences determined in this embodiment for detection are as follows:

[0032] Outer primer 1: GTAAAATCCTGAACGTAGAGAA,

[0033] Outer primer 2: GTTAGGATCAATGTGGAGATG,

[0034] Internal primer 1: ACCCACACTTACACCTAAAGCAG-GTCAATGCTTCATAAAGTATACGA,

[0035] Inner primer 2: GGACAGCAAGGCACTAAACCT-TGAGAACCATCCACATCG.

[0036] On this basis, the Elizabethan meningoseptica ring-mediated constant temperature gene amplification rapid detection kit is designed, which includes:

[0037] (1) Reaction solution 1: composed of 10mmol / L deoxynucleoside triphosphate (dNTP), 10×ThermoPol Buffer reaction buffer, 150mmol / L magnesium sulfate (MgSO 4 ), 5mol / L betaine and sterilized double distilled water (ddH 2 O) Composition;

[0038] (2) Reaction...

Embodiment 2

[0049] negative control

[0050] Step 1, design of primers and assembly of synthetic kits:

[0051] The sequence of primers used for detection determined in this embodiment is the same as that in Example 1.

[0052] On this basis, the Elizabethan meningoseptica ring-mediated constant temperature gene amplification rapid detection kit is designed, which includes:

[0053] (1) Reaction solution 1: composed of 10mmol / L deoxynucleoside triphosphate (dNTP), 10×ThermoPol Buffer reaction buffer, 150mmol / L magnesium sulfate (MgSO 4 ), 5mol / L betaine and sterilized double distilled water (ddH 2 O) Composition;

[0054] (2) Reaction solution 2: composed of 10 μmol / L outer primer 1 (F3), 10 μmol / L outer primer 2 (B3), 40 μmol / L inner primer 1 (FIP) and 40 μmol / L inner primer 2 (BIP);

[0055] (3) 8U / μL Bst DNA polymerase;

[0056] (4) Chromogen: 10wt% SYBR Green I fluorescent dye;

[0057] The reaction solution 1 in the above-mentioned loop-mediated constant temperature gene amplif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an elizabethkingia meningoseptica loop-mediated isothermal DNA amplification detection kit and a detection method, wherein the kit, on the basis of a bio-information platform, is subjected to large-scale genome analysis; four specific primers are designed in accordance with a DNA gyrase gene of the elizabethkingia meningoseptica; and in combination with the LAMP (loop-mediated isothermal amplification of DNA) technology, the rapid, sensitive and accurate detection method is established in accordance with the elizabethkingia meningoseptica, and the rapid detection kit applicable to the method is constructed. With the implementation of the rapid detection kit and the detection method disclosed by the invention, observation and identification with naked eyes can be conducted after a reaction, and any other analysis steps such as electrophoresis and the like can be avoided; the detection kit and the detection method have the advantages of being short in detection time, strong in specificity, low in requirement on instrument and equipment, simple and convenient to operate and the like; and the detection kit and the detection method are applicable to the rapid detection of clinical samples, environment samples, food samples and the like.

Description

technical field [0001] The invention relates to a biological detection reagent for rapid detection of bacterial samples using loop-mediated isothermalamplification of DNA (LAMP) technology, belonging to the technical field of rapid gene molecular diagnostic reagents for Elizabeth meningoseptica, specifically The invention relates to a rapid detection kit and a detection method for Elizabethan meningoseptic ring-mediated constant temperature gene amplification. Background technique [0002] Elizabeth meningoseptica ( Elizabeth kingia meningoseptica ) is a non-fermenting Gram-negative aerobic bacilli with no flagella, no motile, and no spores. Elisabeth meningiseptica is widely distributed in nature and can be detected in river water, seawater and soil. It is worth noting that this bacterium is closely related to the hospital environment and can settle in humid environments such as faucets, sinks, oxygen humidification bottles and even disinfectants in hospitals, forming a p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2531/119C12Q2563/107
Inventor 姜晓冰徐雅梦刘磊李祎张昆于涛
Owner HENAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com