mir-204 and mir-211 and their uses
A technology of uses and reagents, applied in the field of miR-204 and miR-211 and their uses, can solve problems such as increased angiogenesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0117] Materials and Methods
[0118] sequence
[0119] >hsa-mir-204SEQ ID NO:6
[0120]
[0121] - Mature sequence (bold) from base 33 to base 54
[0122] - Seed sequence (underlined) from base 33 to base 39
[0123] >mmu-mir-204SEQ ID NO:7
[0124]
[0125] - Mature sequence (bold) from base 6 to base 27
[0126] -Seed sequence (underlined) from base 6 to base 12
[0127] >hsa-mir-211SEQ ID NO:8
[0128]
[0129] - Mature sequence (bold) from base 26 to base 47
[0130] - Seed sequence (underlined) from base 26 to base 32
[0131] >mmu-mir-211 SEQ ID NO:9
[0132]
[0133] - Mature sequence (bold) from base 26 to base 47
[0134] - Seed sequence (underlined) from base 26 to base 32
[0135] >pAAV.CMV.precursor miR204SEQ ID NO:10
[0136] The underlined sequence is the sequence of pre-miR204
[0137] AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTAT...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com