Method for increasing gel content of eucommia ulmoides
A technology of glue content and cambium, applied in the fields of botanical equipment and methods, biochemical equipment and methods, angiosperms/flowering plants, etc., can solve problems such as undisclosed related gene application methods, and achieve the goal of increasing glue content Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0037] Example 2 Isolation and cloning of EuTIDS5 gene
[0038] Using the Eucommia transcriptome database, a sequence of EuTIDS5 was obtained. The present invention adopts the method of RACE to amplify the complete sequence of EuTIDS5 by using the 5' and 3'-RACE kits of Taraka Company (TaKaRa, Dalian, China). RNA was extracted using QiAgen RNA Extraction Kit (RNeasy Plant mini Kit, QiAgen, Hilden, Germany), and the first strand of cDNA was synthesized according to Inviterogen’s SuperScript TM III First-Strand Synthesis System (Life technologies, Carlsbad, California, U.S.) reverse transcription kit, all were operated according to the kit instructions.
[0039] Use PrimerPremier 5.0 to design primers for the EuTIDS5 sequence for amplification. The primers are as follows:
[0040] Core Fragment Forward (SEQ ID NO:5):
[0041] 5'-AAGGTTGGGATGATTGCGAT-3'
[0042] Core fragment reverse (SEQ ID NO:6):
[0043] 5'-TTTCACGACTAACCAAGTGC-3'
[0044] 5'RACE OuterPrimer (SEQ ID NO: ...
Embodiment 3
[0071] Example 3 Analysis of the expression rule of EuTIDS5
[0072] In order to analyze the relationship between the expression of EuTIDS5 gene in different tissues in different periods and the rubber content, the present invention adopts real-time quantitative PCR (Real-Time PCR), and the reaction is according to the SYBR Premix Ex Taq of TaKaRa Company TM The operation is carried out according to the instructions of the kit, and the two-step method (amplification curve and melting curve curve) is used for amplification. The relative expression of EuTIDS5 in leaves and fruits of Eucommia ulmoides in different periods was analyzed, and the RNA extraction and cDNA synthesis of leaves and fruits of Eucommia ulmoides were the same as in Example 1. The primer used is the housekeeping gene ACTIN forward (SEQ ID NO: 13):
[0073] 5'-TGAGATGCACCACGAAGCTC-3'
[0074] Reverse (SEQ ID NO:14):
[0075] 5'-CCAACATTGTCACCAGGAAGTG-3',
[0076] and gene-specific primer forward (SEQ ID N...
Embodiment 4
[0080] The construction of embodiment 4 plant expression vectors
[0081] The invention adopts the Gateway method to construct the overexpression vector 35S::EuTIDS5 of the key enzyme gene of rubber synthesis and the RNA interference vector RNAi-EuTIDS5. According to the construction requirements of the Gateway vector (which has been circulated and used by major scientific research institutions in my country, here presented by the Chen Jun Deputy Research Institute of the Chinese Academy of Forestry Sciences): cloning of the target fragment, construction of the entry vector, and construction of the expression vector.
[0082] 1. Cloning of the target fragment
[0083] Utilize Primer Premier 5.0 to design primers and add sequences with Gateway adapters at both ends of the primers as follows (the underlined part is the Gateway adapter sequence) to overexpress the primers:
[0084] Forward (SEQ ID NO:17):
[0085] 5'– GGGGACAACTTTGTACAAAAAAGTTGGA ATGGCGGAAACGACCCA-3'
[0086...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap