Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR

A technology of HLA-B and alleles, applied in the field of alleles, can solve the problems of difficult combination of primers and probes, and achieve the effects of saving experimental time and consumables, short time consumption, and easy operation

Active Publication Date: 2015-01-21
SHANXI LIFEGEN
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, compared with the detection of HLA alleles, this technology has rarely been applied to the detection of HLA‐B*5801 alleles; the fundamental reason is that multiple HLA‐B alleles are highly correlated with HLA‐B*5801 Therefore, it is very difficult to design a set of primer-probe combinations suitable for the high-specificity amplification of HLA-B*5801 alleles in fluorescent PCR reactions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR
  • Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR
  • Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment

[0041] Specific examples TaqMan-MGB probe method for detection of HLA-B*5801 alleles

[0042] 1. DNA sample extraction and dilution

[0043] After collecting venous blood in vacuum blood collection tubes anticoagulated with ethylenediaminetetraacetic acid (EDTA) according to conventional methods, DNA was extracted using the QIAamp DNA Mini Blood Kit (Qiagen, Germany) kit; the extracted DNA was concentrated using NanoDrop 2000 Determination (A 260 / 280 =1.95~2.15). Using the above method, the concentration of DNA samples of 104 cases of Bouyei was measured, and then the samples were diluted to 10 ng / μL with PCR-grade H2O.

[0044] 2. Design primers and probes

[0045] In the area where the polymorphic sites are concentrated, use the ARMS method to design specific primers for HLA‐B*5801, the upstream primer F: 5'‐GGGCCGGAGTATTGGGATG‐3', the downstream primer R: 5'‐TTGGCCTCAACTGAAAATGAAAC‐3', and matching Fluorescent probe probe: 5'‐HEX / VIC‐TCAGGGAGGCGGATCTCGGAC–MGB‐3'; In add...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention designs a primer-probe combination capable of amplifying HLA-B * 5801 allele with high specificity based on a TaqMan probe detecting method: Fp: 5'-AGGGGCCGGAGTATTGGGATG-3', Rp:5'-TTGGCCTCAACTGAAAATGAAAC-3', MGB probe: 5'-HEX-VI-TCAGGGAGGCGGATCTCGGAC-MGB3'; meanwhile, by virtue of primers and probes for a reference gene ACTB, a target gene and the reference gene are added into a tube to have a dual-channel fluorescence quantitative PCR reaction, and the result is analyzed by an amplification curve. The method provided by the invention is simple and convenient, flexible, fast, high in specificity, high in throughput, pollution-free, and high in resolution, and is applicable to detection of the HLA-B * 5801 allele of whole genome DNA samples in human peripheral blood and saliva.

Description

technical field [0001] The invention belongs to the field of pharmacogenomics and gene detection, in particular to a method for detecting HLA‐B*5801 alleles. Background technique [0002] HLA refers to human leukocyte antigen, which is encoded by a group of closely linked multiple alleles on the short arm of human chromosome 6. It consists of 3.6 million base pairs. It is the highest gene density in the currently known human chromosome and is also a polymorphism. most abundant area. Mainly including HLA-A, HLA-B, HLA-C, HLA-DR, HLA-DQ and HLA-DP. The number of related HLA alleles named by the World Health Organization's HLA Factor Nomenclature Committee has reached more than 5,000; the polymorphism of HLA genes determines the difference in the expression of HLA protein molecules between individuals, and also determines the ability of different individuals to process and present the same antigen Different, this is the most basic point of induction and regulation of immune r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q2561/101C12Q2545/101
Inventor 康星王会娟陈融刘金辉戴鹏高陈超
Owner SHANXI LIFEGEN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com