Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SSR molecular marking method of wheat grain hardness gene

A wheat grain and molecular marker technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as low detection sensitivity, and achieve the effect of high allelic diversity and high stability

Active Publication Date: 2014-04-30
CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the main detection methods of SNP have the following defects: 1. Traditional detection methods based on gel electrophoresis, such as restriction fragment length polymorphism, denaturing gradient gel electrophoresis, allele-specific PCR, etc., have low detection sensitivity; 1. Nucleotide sequencing method requires an expensive 3730 sequencer, and the cost of each sample is about 10 yuan; 3. Gene chips also require expensive instruments. 4. Taqman probe method, the cost of synthesizing a fluorescent primer is 300 yuan Yuan or so

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0008] This specific embodiment adopts the following technical scheme: it designs a PCR primer containing the SSR in a nucleotide sequence closely linked with the hardness gene and has the characteristics of an SSR, and after performing PCR amplification on the target variety, the polyacrylamide electrophoresis , can determine the allelic variation of Pina and Pinb genes among varieties.

[0009] Described nucleotide sequence is:

[0010] TTATTACTCACCTCGATTTTTGTTTGTAAGTGTGTTTATTTATTGGTCAAAGATAATTGTTTCTGGGGAAAAATGAAGGATTAGAAGAAGCTTGTCATGTGCCGAATCTCAATCTTCGATAAACCAAGGGAGAATAATTAGAAAAGATGGCTATCTAATATGACTCATTGCACTTTCTAGGTCAGAATCAAAACCCTTTTATGGCATTGTACATGGGGAGGTGAGCTCTGTTCTAAGGTTAATCCTAACCCGTGTTGTTTGAAATACCTATTTACCCCCTCCGATGCATCTAGATCCTCGGACACCTTGTTAAAAAAAATTACTTCCTTGGAGACAAATACTATTTTGGAGAATAATGAAAATCATTTAGAAACATTTGACATGAACGACATGATTCCAGAGACAATAAAAAACTTAAAAACAAACGATGGATAAGAAGATGATGTCTTGATAAATCATTACTTGTCGAGTTGTCGTGTACTACTAGTCTGTAAAATACAGTCTCTAACAAATTTGGTACAATCTGAGATCCATCTTGAACAACCTGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a SSR molecular marking method of a wheat grain hardness gene and relates to the technical field of wheat molecular marker-assistant breeding. The SSR molecular marking method is characterized in that a PCR primer containing a microsatellite repetition section is designed in a microsatellite-feature nucleotide sequence tightly linked with a hardness gene; the target specie is subjected to PCR amplification; and then allelic variation of Pina and Pinb genes of different species is determined by polyacrylamide electrophoresis. The SSR molecular marking method has the advantages of simpleness, high speed, high stability and high allele diversity and realizes molecular marking only by common polyacrylamide electrophoresis.

Description

Technical field: [0001] The invention belongs to the technical field of wheat molecular marker assisted breeding, and relates to an SSR molecular marker method of wheat grain hardness gene. Background technique: [0002] Grain hardness is an important basis for grading and pricing domestic and foreign wheat markets. It can affect the particle size of flour, the flour extraction rate, the amount of water added for moistening wheat, and the number of damaged starch granules. Flour milled from wheat with a small hardness value has a smaller particle size, low content of damaged starch, and weak water absorption capacity, while flour milled from wheat with a large hardness value has a large particle size, high content of damaged starch, and strong water absorption capacity. Differences in these properties affect the properties of the kneaded dough and thus the type of food being prepared. For example, soft wheat is suitable for making sweet foods such as biscuits and pastries;...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 张怀刚刘宝龙李善福刘登才张波陈文杰沈裕虎李建民魏乐
Owner CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More