Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and primers for detecting mutation site of exon 3 of runx1 gene

A technology of mutation sites and exons, which is applied in the fields of life science and biology, can solve the problems of high detection cost, low detection sensitivity, and large amount of sample DNA, achieving high specificity and accuracy, high sensitivity, and simple operation Effect

Active Publication Date: 2016-01-20
SHENYANG ADICON CLINICAL LAB CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

ssCp technology is relatively simple, but the restriction site is easily affected by gene variation, which affects the judgment of the result. Due to the technical limitations of the method itself, the detection sensitivity is low
Fluorescence quantitative PCR method was used to detect the mutation of exon 3 of RUNX1 gene. Since the detected exon sequence was long and involved multiple mutation sites, it was necessary to design multiple pairs of primers and probes. Three mutant probes were designed. Specifically bind to the 3 mutation sites covered by the third exon of the RUNX1 gene, and design 3 corresponding wild-type probes to bind to the unmutated DNA of the 3 sites respectively. To detect a DNA sample, 3 Tube PCR reaction, each tube reaction system includes 1 pair of amplification primers, 1 wild-type probe, 1 corresponding mutant probe, the amount of sample DNA is relatively large, and the detection cost is also high, which brings great advantages to clinical applications. Inconvenience
In addition, the existing technology only detects a single point mutation with a high probability of mutation, but does not detect the overall mutation of the third exon

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primers for detecting mutation site of exon 3 of runx1 gene
  • Method and primers for detecting mutation site of exon 3 of runx1 gene
  • Method and primers for detecting mutation site of exon 3 of runx1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Primers for detecting the mutation site of the third exon of the RUNX1 gene, including: forward and reverse primers for amplifying the mutation site of the third exon of the RUNX1 gene; its base sequence is:

[0044] RUNX1-exon3-F: CCTAACTCAATCGGCTTGTTGT

[0045] RUNX1-exon3-R: GGCCAGTACCTTGAAAGCGAT.

[0046] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is

[0047] RUNX1-exon3-S-F: CCTAACTCAATCGGCTTGTTGT

[0048]RUNX1-exon3-S-R: GGCCAGTACCTTGAAAGCGAT.

[0049] In the detection, first use the above-mentioned forward and reverse primers to amplify the DNA fragment covering the mutation site of exon 3 of the RUNX1 gene to obtain the amplified product, and then use the above-mentioned pair of sequencing primers to sequence the amplified product, Obtain the gene sequence of the amplified product.

[0050] Kits for detecting the mutation site of exon 3 of the RUNX1 gene, including: tissue DNA extraction kit (for example, us...

Embodiment 2

[0062] The operation process of the blood DNA extraction kit (Tiangen Biology):

[0063] (1) Genomic DNA extraction from blood:

[0064] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.

[0065] 2) Add 20 μl proteinase K solution and mix well.

[0066] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0067] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0068] 5) Add the solution and flocculent pre...

Embodiment 3

[0094] The nucleic acid detection kit of the present invention is used to detect clinical specimens.

[0095] 20 cases of anticoagulant blood samples from patients with acute myeloid leukemia (AML) were taken for inspection. The control group experiment of these 20 samples was completed by the outsourcing company through fluorescent quantitative PCR method. The test results are shown in Table 1 below.

[0096] The experimental group extracted genomic DNA from samples according to the method described in Example 2, prepared reagents and tested them. Add 2 μl of each sample to the detection system PCR reaction solution. Do positive, negative and blank controls at the same time, each sample has 2 repetitions, one positive control, one negative control and one blank control. The detection time is 160 minutes.

[0097] After each sample has been sequenced twice, the mutation status will be compared, and a third sequence will be performed for samples with inconsistent results. Fi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and primers for detecting a third exon mutation site of a RUNX1 gene. Both the primers and the method comprise a forward primer, a reverse primer and a pair of sequencing primers. By adopting a Sanger sequencing method and by utilizing the pair of sequencing primers, the method and the primer can be used for rapidly detecting mutation conditions of the third exon mutation site of the RUNX1 gene in an acute myeloid leukemia patient body.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, in particular to a primer and a method for detecting the third exon mutation site of RUNX1 gene. Background technique [0002] Acute myeloid leukemia (AML) is a malignant disease caused by cumulative acquired gene changes in myeloid hematopoietic stem / progenitor cells, resulting in changes in cell proliferation, differentiation and apoptosis pathways. [0003] RUNX1, also known as AML1, is a member of the RUNX transcription factor protein family and is the most common target site of leukemia chromosomal translocation. RUNX1 is a very important transcription factor that can bidirectionally (promote or inhibit) regulate hematopoietic-related factors, thereby regulating the differentiation, apoptosis and self-renewal of hematopoietic stem cells. RUNX1 point mutations can often occur in myelodysplastic syndrome (MDS), AML, chronic myelomonocytic leukemia (CMML), and less commonly in mye...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6869C12Q1/6886C12Q2600/118C12Q2600/156C12Q2535/101C12Q2531/113
Inventor 李文静陈奕磊周晓犊
Owner SHENYANG ADICON CLINICAL LAB CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com