Method and primers for detecting mutation site of exon 3 of runx1 gene
A technology of mutation sites and exons, which is applied in the fields of life science and biology, can solve the problems of high detection cost, low detection sensitivity, and large amount of sample DNA, achieving high specificity and accuracy, high sensitivity, and simple operation Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Primers for detecting the mutation site of the third exon of the RUNX1 gene, including: forward and reverse primers for amplifying the mutation site of the third exon of the RUNX1 gene; its base sequence is:
[0044] RUNX1-exon3-F: CCTAACTCAATCGGCTTGTTGT
[0045] RUNX1-exon3-R: GGCCAGTACCTTGAAAGCGAT.
[0046] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is
[0047] RUNX1-exon3-S-F: CCTAACTCAATCGGCTTGTTGT
[0048]RUNX1-exon3-S-R: GGCCAGTACCTTGAAAGCGAT.
[0049] In the detection, first use the above-mentioned forward and reverse primers to amplify the DNA fragment covering the mutation site of exon 3 of the RUNX1 gene to obtain the amplified product, and then use the above-mentioned pair of sequencing primers to sequence the amplified product, Obtain the gene sequence of the amplified product.
[0050] Kits for detecting the mutation site of exon 3 of the RUNX1 gene, including: tissue DNA extraction kit (for example, us...
Embodiment 2
[0062] The operation process of the blood DNA extraction kit (Tiangen Biology):
[0063] (1) Genomic DNA extraction from blood:
[0064] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.
[0065] 2) Add 20 μl proteinase K solution and mix well.
[0066] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0067] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0068] 5) Add the solution and flocculent pre...
Embodiment 3
[0094] The nucleic acid detection kit of the present invention is used to detect clinical specimens.
[0095] 20 cases of anticoagulant blood samples from patients with acute myeloid leukemia (AML) were taken for inspection. The control group experiment of these 20 samples was completed by the outsourcing company through fluorescent quantitative PCR method. The test results are shown in Table 1 below.
[0096] The experimental group extracted genomic DNA from samples according to the method described in Example 2, prepared reagents and tested them. Add 2 μl of each sample to the detection system PCR reaction solution. Do positive, negative and blank controls at the same time, each sample has 2 repetitions, one positive control, one negative control and one blank control. The detection time is 160 minutes.
[0097] After each sample has been sequenced twice, the mutation status will be compared, and a third sequence will be performed for samples with inconsistent results. Fi...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com