Fusion protein used for preparing human cytokine induced killer cells
A fusion protein and cell-killing technology, which is applied in the fields of biotechnology and medicine, can solve problems such as insufficient effective treatment, and achieve the effect of improving tumor-killing activity and enhancing tumor-killing activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 Obtaining of fusion protein
[0048] 1. Obtaining the target gene
[0049] According to the human ICAM-1 and FN gene sequences, two pairs of primers were designed: forward primer P1 and reverse primer P2 of human ICAM-1; forward primer P3 and reverse primer P4 of human FN. And the target gene sequence was obtained by two-step PCR. The primer sequences are as follows:
[0050] Pl: 5'-CATCATCATCATCATCAT CATATG CAGACATCTGTGTCCCC-3' (SEQ ID NO: 3)
[0051]
[0052] GGTGTTCT-3' (SEQ ID NO: 4)
[0053]
[0054] GATTCAC-3' (SEQ ID NO: 5)
[0055] P4: 5'-AGACTGCAGGTCGAC AAGCTT TTATGTGGAAGGAACATCCAA
[0056] GAT-3' (SEQ ID NO: 6)
[0057] The 5' end of the P1 primer introduces an NdeI restriction site (underlined and italicized part), and the 5' end of the P2 primer introduces the complementary sequence (boxed part) of the flexible peptide GGGGSGGGGS (SEQ ID NO: 1) cDNA to contain human ICAM-1 The plasmid with cDNA sequence (purchased from Origene) was u...
Embodiment 2
[0108] Example 2 Preparation of CIK cells
[0109] 1. Preparation of CIK cells
[0110] (1) 75cm 2 Handling of culture bottles
[0111] The coating solution was prepared with DPBS, containing 5 μg / ml of human CD3 monoclonal antibody and 10 μg / ml of the ICAM-FN fusion protein obtained in Example 1. Take 10ml of coating solution, add to 75cm 2 Store in a culture bottle overnight at 4oC in the dark.
[0112] (2) Preparation of mononuclear cells
[0113] Obtain 100ml of fresh peripheral blood, centrifuge (700g, 20min), and divide into two layers after centrifugation, the upper layer is plasma, and the lower layer is blood cells. After the upper layer of plasma was processed, it was stored at 4oC for future use. The blood cells in the lower layer were diluted to 100ml with DPBS, and the mononuclear cells were separated with lymphocyte separation medium with a specific gravity of 1.077, washed twice with DPBS, observed and counted under a microscope, and finally mixed with 5% ...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap