Cotton stearyl desaturase gene GbSSI2 and application thereof
A stearoyl and gene technology is applied to the cloning of cotton stearoyl desaturase gene GbSSI2, the application field in controlling cotton's resistance to verticillium wilt, and can solve the problems of lack of jasmonic acid synthesis regulation research and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1: GbSSI2 gene isolation clone
[0038] 1. Expression Analysis
[0039] The previous work of the applicant of the present invention was to study the differential expression of proteins in the roots of sea-island cotton 'Hai 7124' after being inoculated with Verticillium dahliae, and found a protein spot whose expression changed significantly after being inoculated with Verticillium dahliae ( figure 2 A), a gene was identified by this protein spot by tandem mass spectrometry analysis, and semi-quantitative PCR (RT-PCR) was used to identify the gene. 'Hai 7124' showed an up-regulation pattern compared to the water-receiving control ( figure 2B). The total protein of cotton roots inoculated with Verticillium dahliae was extracted from the sea-island cotton line 'Hai 7124', and the extraction method was TCA / acetone combined with phenol extraction (Yao, Y., Yang, Y.W., Liu J.Y.2006, An efficient protein preparation for Proteomic analysis of developing cotton fi...
Embodiment 2
[0056] Example 2: Expression Analysis of GbSSI2 Gene in Different Tissues of Cotton and Response to Plant Resistance Signaling Molecules
[0057] Using sea island cotton 'Hai 7124' as material, extract the RNA of 8 different tissues including root, stem, cotyledon, true leaf, fiber, ovule, petal and anther (see Example 1 for the extraction method and RNA reverse transcription method), and use RT-PCR method was used to detect the expression level of GbSSI2 gene. Using the cDNA synthesized by the above reverse transcription as a template, the gene GbSSI2 obtained in Example 1 was used to design specific primers GbSSI2Rt-s (5'CGCCACGAGACAGCATACACTAA 3') and GbSSI2Rt-a (5'CAGAAACCCAACTGAATGGAACAC 3') to carry out PCR amplification of the GbSSI2 gene increase. At the same time, primers UB7-s (5'GAAGGCATTCCACCTGACCAAC3') and UB7-a (5'CTTGACCTTTCTTCTTCTTGTGCTTG3') were used to specifically amplify the cotton GhUbi7 (GenBank accession number: DQ116441) gene as an internal control for...
Embodiment 3
[0059] Example 3: Construction of virus interference vector, RNAi suppression expression vector and overexpression vector and transformation mediated by VIGS
[0060] The specific method of VIGS-mediated cotton plant transformation is as follows: the Agrobacterium strain with pTRV:RNA1, pTRV:RNA2 and pTRV2:GbSSI2 was treated with 50 μg / mL Kanamycin (Kanamycin, purchased from Sigma, the U.S.) Activation on LB dishes. Two days before inoculation, pick a single clone and inoculate it in 5ml LB culture medium. Add 50 μg / mL Kanamycin (Kanamycin) to the LB culture medium. overnight on a shaker at 28°C with a rotational speed of 50 rpm. Inoculate the activated bacterial solution into 100ml of Kanamycin LB culture solution containing 50μg / mL, and add 10mM 4-morpholinoethanesulfonic acid, referred to as MES (2-(4morpholino)-ethanesulfonic acid), 20μM acetosyringone . overnight at 28°C on a shaker at 50 rpm. When the concentration of Agrobacterium OD 600 =0.8 or so, the bacterial ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap