Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cotton cytochrome P450 gene and application

A technology of cytochrome and cotton, which is applied in the field of plant genetic engineering, can solve the problems of low gene homology, etc.

Active Publication Date: 2015-03-04
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Bioinformatics analysis shows that it has low homology with other known plant P450 genes, indicating that this is a new plant P450 gene, and its function has not been reported in cotton

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton cytochrome P450 gene and application
  • Cotton cytochrome P450 gene and application
  • Cotton cytochrome P450 gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1: GhSSN gene isolation clone

[0050] 1. Expression Analysis

[0051] The previous work of the applicant of the present invention was to study the differences in gene expression in the roots of sea-island cotton 'Hai 7124' after being inoculated with Verticillium dahliae, and found a gene whose expression changed significantly after being inoculated with Verticillium dahliae through analysis. Real-time quantitative PCR identification showed that the expression pattern of this gene was significantly different after inoculation of Verticillium dahliae 'V991' between the resistant sea-island cotton 'Hai 7124' and the susceptible upland cotton 'YZ-1' (see figure 1 B. figure 1 C). Total RNA was extracted from cotton roots inoculated with Verticillium dahliae from the upland cotton line 'YZ-1' (the extraction method was based on Zhu et al., An improved simple protocol for isolation of high quality RNA from Gossypium spp.suitable for cDNA library construction, A...

Embodiment 2

[0054] Example 2: GhSSN expression analysis in different tissues of cotton and response to plant disease resistance signaling molecules

[0055] Using upland cotton 'YZ-1' as material, RNA was extracted from the following three different tissues, and Real-time PCR was used to detect the expression level of GhSSN gene. The three selected tissues are: 1. Root; 2. Stem; 3. Leaf. Cotton total RNA extraction method is according to the literature published by Zhu et al. (An improved simple protocol for isolation of high quality RNA from Gossypium spp. suitable for cDNA library construction. Acta Agronomica Sinica. Afterwards, it was treated with DNaseI (purchased from Promega), and the RNA integrity was detected by 1.2% (w / v) agarose gel (EtBr) electrophoresis (5V / cm). The nucleic acid concentration was measured on a Beckman DU800spectr photometer (Beckman, USA). The RNA 260 / 280 ratio was between 1.9 and 2.1, and the RNA with a 260 / 230 ratio greater than 2.0 was used for the next ...

Embodiment 3

[0057] Example 3: Construction and Transformation of Overexpression Vectors and RNAi Inhibition Expression Vectors

[0058] In order to verify the function of the GhSSN gene, the applicant constructed an overexpression and RNAi suppression expression vector to transform cotton.

[0059] Design overexpression primers according to the GhSSN obtained in Example 1, add attB site sequences and protective bases for recombination at both ends of the primers, that is, add 5' GGGGACAAGTTTGT ACAAAAAAGCAGGCTGC 3' linker at the 5' end of the sense primer, and antisense A 5' GGGGACCACTTTGTA CAAGAAAGCTGGGTG3' linker was added to the 5' end of the primer, and the primers were named GhSSNoe-F (5'GGGGAC AAGTTTGTACAAAAAGCAGGCTGCATTCTCTACACTTTCTTAACACAGCA G3') and GhSSNoe-R (5'GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCTGT CCTTCGCCACTTTAT) respectively. Then use the cDNA of the GhSSN gene as a template for PCR amplification, and the obtained PCR product is constructed on the intermediate vector pDNOR221 (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cotton cytochrome P450 gene and an application, and also discloses a gene expression vector containing a sequence shown in SEQ ID NO.1 or EQ ID NO.2, wherein the vector facilitates synthesis of jasmonic acid and accumulation of an active form by expression of a dual-chain nucleic acid molecule formed by a nucleotide sequence and restraining expression of a cotton endogenous gene GhSSN. The invention also provides a host cell containing the expression vector; and the host cell comprises escherichia coli, agrobacterium and cotton cells. The invention also discloses an application of a cotton cytochrome oxidase gene GhSSN in control of a cotton verticillium wilt, and synthesis of the jasmonic acid is controlled by adjusting the expression of the GhSSN or equivalent homologous gene in a cotton plant. Preferential expression of the GhSSN gene in cotton root and cotyledon has the function of controlling synthesis of the jasmonic acid, so that the cotton cytochrome P450 gene can be applied to cultivation of products for the cotton verticillium wilt by genetic transformation, and simultaneously can be used as a marker gene of cotton verticillium wilt reaction.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to a cotton cytochrome P450 gene, and also relates to the application of a cotton cytochrome oxidase gene in controlling cotton resistance to Verticillium wilt. Using the method of reverse genetics, through the analysis of the expression profile of cotton resistance to Verticillium wilt, the isolated and cloned GhSSN gene is a gene that controls the synthesis of jasmonic acid in cotton, which can affect the resistance of cotton to Verticillium wilt. Background technique [0002] Cotton verticillium wilt is one of the main diseases that harm my country's cotton production at present. It reduces the production of my country's cotton production by 10-20% all the year round. In some areas, it is as high as 70% when the disease is severe. It has become one of the main obstacles to the sustainable development of my country's cotton production. one. In 1993, the incidenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/63A01H5/00
Inventor 张献龙朱龙付孙龙清
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com