Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Kit for detecting deaf related mitochondrial T7505C mutation, and application thereof

A technology of T7505C and mitochondria, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve problems such as troubles, and achieve the effects of relieving pain, simple detection process, and intuitive result interpretation

Active Publication Date: 2015-04-08
ZHEJIANG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This blood collection method has brought some pain and injury to many subjects, especially infants and young children, and there are certain risks and troubles when transferring samples across regions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting deaf related mitochondrial T7505C mutation, and application thereof
  • Kit for detecting deaf related mitochondrial T7505C mutation, and application thereof
  • Kit for detecting deaf related mitochondrial T7505C mutation, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1 A kit of the present invention

[0038] see figure 1 , the kit provided by the present invention consists of DNA extraction mixture 1, PCR mixture 2 for amplifying T7505C fragments, a pair of outer primers 3 designed for T7505C, inner primers 4 designed for T7505C, restriction endonucleases 5, positive Control 6, negative control 7 and box body 8, wherein DNA extraction mixture 1 is mainly composed of cell lysate, proteinase K solution, chloroform, phenol, and absolute alcohol; PCR mixture 2 for amplifying the T7505C fragment includes dNTP (deoxymononucleotide), 10×PCR buffer, MgCl 2 , triple distilled water and Taq Enzyme (DNA polymerase), outer forward primer F designed for T7505C: ACG CCA AAA TCC ATT TCA CT (SEQ ID NO:1), outer reverse primer R: CGG GAA TTG CAT CTG TTT TT (SEQ ID NO: 2); The inner primers designed for T7505C include inner forward primer F: TAGACAAAAAAGGAAGGAATCGAACCCCCAAAGCTGGTTTCAAAGCCAACCGCTTGGCCTCCA (SEQ ID NO: 3), inner reverse p...

Embodiment 2

[0040] Example 2 Carrying mitochondrial tRNA Ala Detection of deaf families with T7505C mutation

[0041] 1. Test samples

[0042] A deaf family carrying the T7505C mutation was selected. See his pedigree Figure 4 . This family showed typical maternal inheritance, and the only clinical symptom was elevated blood pressure in all patients, but the degree of elevated blood pressure of each affected member in the family varied. The total number of people in this family is 18, including 9 members of the maternal line and 7 people who are deaf.

[0043] 2. Extraction of Genomic DNA

[0044] Samples from 4 subjects were obtained respectively (including a drop of venous blood filter paper from the capillaries of Ⅰ-1 and Ⅲ-1; Ⅱ-1 was the oral mucosa scraping or saliva; Ⅱ-2 was the hair with hair follicles), and the Use clean scissors to cut the blood filter paper into pieces of paper about 1cm2 in size, put them into a 1.5ml EP tube (Eppendorf tube), add 900μl red blood cell ly...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting deaf related mitochondrial DNA T7505C mutation. The kit is composed of a DNA extraction mixed liquid, a PCR mixed liquid for T7505C fragment amplification, a pair of outer primers designed against T7505C, a pair of inner primers designed against the T7505C, a restrictive endonuclease, a positive contrast, a negative contrast and a kit body. A protease K digestion cracking method is utilized in the invention to rapidly extract genome DNA from a small amount of specimens, so a problem of the traditional extraction of DNA from the blood of a deaf patient is solved, the pains of a detected person is mitigated, and a trans-regional sample transmission problem is also solved. The kit has the advantages of low application cost, simple and rapid detection flow, visual result interpretation, ensuring of the specificity and the stability of the detection result, and realization of the application in the detection of the deaf related mitochondrial tRNAGlnT7505C mutation.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a kit for detecting the mitochondrial DNA T7505C mutation related to deafness, and also relates to a detection method for the mitochondrial gene mutation related to deafness, in particular to detecting mitochondrial tRNA Ser(UCN) The method for the T7505C mutation, and the application of the above-mentioned method or the above-mentioned kit in detecting the mitochondrial DNA T7505C mutation related to deafness. Background technique [0002] Deafness is a common disabling disease that causes speech communication barriers and is one of the greatest sufferings of human beings. According to WHO estimates in 2005 that there were 278 million hearing disabled people in the world, accounting for 4.6% of the world's total population; 80% of hearing disabled people live in low- and middle-income countries. Deafness has become a serious health and safety problem in my country, bringing ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 管敏鑫蒋萍萍冀延春郑静梁敏徐静
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com