Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

New method for pest control on basis of ribonucleic acid interfere (RNAi) technology

A gene, insect technology, applied in recombinant DNA technology, DNA/RNA fragments, botanical equipment and methods, etc., can solve problems such as cotton bollworm death

Active Publication Date: 2012-11-28
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF3 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the use of RNAi technology for pest control has been reported. Baum et al. (2007) proved that v-ATPase has a lethal effect on corn rootworm WCR Diabrotica virgifera virgifera LeConte, and can be used for field control; in the same year, mao By introducing the dsRNA of P450 into cotton, it can lead to the death of cotton bollworm (cotton bollworm Helicoverpa armigera); Tian (2009) confirmed that the method of feeding can lead to the death of beet armyworm (Spodoptera exigua (Hübner)), a series of The prior art shows that RNAi technology is feasible as a novel pest control method, but previous studies have also shown that there are still many problems to be solved in the pest control based on RNAi technology, such as: 1) How to quickly and high-throughput 2) How to easily apply it to field production; 3) Resistance issues; 4) Safety issues, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New method for pest control on basis of ribonucleic acid interfere (RNAi) technology
  • New method for pest control on basis of ribonucleic acid interfere (RNAi) technology
  • New method for pest control on basis of ribonucleic acid interfere (RNAi) technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0249] Example 1. Obtaining target gene information

[0250] Taking the analysis of the Asian corn borer as an example, the method steps are as follows:

[0251] 1. Extraction of total RNA from Ostrinia officinalis

[0252] Extract by conventional Trizol method, purify by conventional method, and treat with DNase to obtain a Total RNA sample with a concentration ≥ 300 ng / μl, a total amount ≥ 6 μg, and an OD260 / 280 of 1.8-2.2.

[0253] 2. Isolation of mRNA and synthesis of cDNA

[0254] The mRNA with polyA was isolated using magnetic beads with oligo-dT, and then the first-strand cDNA was synthesized using random 6-mers and Invitrogen's Superscript II reverse transcriptase kit.

[0255] 3. Gene amplification and sequencing

[0256] Target gene-specific primers (OfSPF: CATGGGGACACAGTTGAGCTTC (SEQ ID NO: 14); OfSPR: TGCTGTAAATCTAGCCTCAGTCA (SEQ ID NO: 15)) were used for amplification, and the obtained gene fragments were purified and ligated to (manufactured by Takara) PMD-18 I...

Embodiment 2

[0260] The synthesis of embodiment 2, dsRNA

[0261] Utilize the method described in the present invention, apply in the middle of the research of corn borer, the inventor selects three structural domains (SP-N, SP-M, SP-C, sequence see Table 2) of storage protein 2 gene, amplifies The primers required for the three domains are shown in Table 3.

[0262] Table 2. Sequences of the three structural domains of the storage protein 2 gene

[0263]

[0264]

[0265] Table 3. Primers used in the synthesis of dsRNA

[0266]

[0267] Among them, EYFP is the enhanced yellow fluorescent protein gene, which is used as the control of exogenous gene.

[0268] The primers described in Table 3 were used to amplify the DNA sequences of the three domains SP-N, SP-M, and SP-C of the storage protein 2 gene as templates for synthesizing dsRNA.

[0269] use T7Kit (purchased from AMBION, product number AM1334) was used to synthesize target gene dsRNA to obtain dsRNA that can be used fo...

Embodiment 3

[0289] Embodiment 3, the silencing effect of dsRNA on the gene of Ostrinia oleatus

[0290] The inventors obtained dsSP-C (dissolved in ddH 2 O) Spray directly on the 1st instar larvae of Ostrinia officinalis, and observe the changes of its gene expression. See the gene expression of storage protein 2 gene (ds OfSP) at 0, 1, 3, and 5 days after spraying Figure 5 .

[0291] From Figure 5 From the results, it can be seen that the expression of this gene was significantly suppressed at day 5 after treatment with dsRNA. Similarly, protein electrophoresis identification found that the expression of storage protein 2 was also significantly inhibited.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to a new method for pest control on the basis of a ribonucleic acid interfere (RNAi) technology. A target gene and an encoded protein thereof which are used for controlling Lepidoptera insects are disclosed, a nucleic acid inhibitor or a host which expresses the nucleic acid inhibitor is prepared on the basis of the nucleotide sequence of the target gene, so the Lepidoptera insects can be effectively killed. The invention further provides a pesticide formulation for special types and interspecific broad-spectrum types and a method through utilizing different segments of the same gene.

Description

technical field [0001] The invention belongs to the fields of biotechnology and pesticide science; more specifically, the invention relates to a new method for controlling pests based on RNAi technology. Background technique [0002] The Asian corn borer (Ostrinia furnacalis Guenée) and the cotton bollworm (Helicoverpa armigera Hubner) are important worldwide agricultural pests. The Asian corn borer mainly harms important food crops such as corn, sorghum, and sunflower, and the cotton bollworm mainly harms more than 20 crops such as cotton and vegetables. There are more than 200 kinds of important crops. The perennial damage area of ​​diamondback moth accounts for about 10% of the total vegetable planting area (2010 vegetable planting area was 33.33 million hm 2 , the occurrence area of ​​Plutella xylostella reached 2.53 million hm 2 ; 2009 vegetable planting area 30 million hm 2 , the occurrence area of ​​Plutella xylostella reached 2.7 million hm 2 ), the resulting los...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12C12N15/63C12N1/21C12N1/15C12N1/19C12N5/10C12N15/113A01N61/00A01P1/00A01P3/00A01P5/00A01P7/02A01P7/04A01P13/00A01P7/00A01H5/00A01H5/10
CPCC12N2310/14C12N15/8286C07K14/43563A01N37/46C12N15/113Y02A40/146A01N63/60A01N2300/00
Inventor 苗雪霞张浩李海超王玉冰
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com