Detection method of JC virus as well as kit and application thereof
A detection kit, JC virus technology, applied in the determination/inspection of microorganisms, methods based on microorganisms, microorganisms, etc., can solve the problems of no detection methods or reagents, and achieve timely case diagnosis and treatment and treatment effect monitoring, effective and accurate Quantitative detection, good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0077] 1. Design of primers and probes: Design specific primers JCV-F and JCV-R for the JC virus genome, and Taqman fluorescent probe JCV-P. The fluorescent group labeled at the 5' end of Taqman fluorescent probe JCV-P is 6-carboxyfluorescein (6-carboxyfluorescein, FAM), and the quencher group labeled at the 3' end is Black Hole Quencher 1 (Black Hole Quencher 1 , BHQ1).
[0078] JCV-F: GGTATACACAGCAAAAGAAGCAACA;
[0079] JCV-R: CAGTGATGATGAAAACACAGGATCC;
[0080] JCV-P: GCATGCAGATCTACAGGAAAGTCTTTAGGGT;
[0081] (sequence direction 5'-3')
[0082] 2. Preparation of the JC virus DNA polymerase chain reaction solution: mix the components (primers, probes and reaction buffer) together in a certain proportion. The polymerase chain reaction solution for a single reaction includes: 2.5 μl of 10× reaction buffer, 0.60 μl of JCV-F (10 μM), 0.30 μl of JCV-R (10 μM), 0.70 μl of JCV-P (10 μM), 3.0 μl of dNTP, and finally Make up the reaction system to 19.8 μl with sterile ultrapure ...
Embodiment 2
[0098] The construction of embodiment 2JCV quantitative standard substance I-IV:
[0099] (1) Preparation of detection reaction system: PCR reaction solution 19.8 μl, DNA polymerase 0.2 μl, purified virus genome 5.0 μl, perform PCR reaction, the reaction conditions of PCR reaction are: 94°C, 4 minutes; 94°C, 15 seconds; 60°C, 35 seconds, 40 cycles;
[0100] The PCR reaction solution includes: 10× reaction buffer 2.5 μl, JCV-F (10 μM) 0.60 μl, JCV-R (10 μM) 0.30 μl, JCV-P (10 μM) 0.70 μl, dNTP 3.0 μl, and finally use sterile ultrapure Water was used to make up the reaction system to 19.8 μl.
[0101] (2) Insert the amplified product into the T vector to construct a recombinant plasmid, and after gene sequencing confirms that it is correct, the recombinant plasmid is transformed into bacteria and amplified.
[0102] The obtained DNA sequence was directly connected to the pSTV28 DNA vector by T4 phage DNA ligase, and the pSTV28 DNA vector was purchased from Takara Company. The...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com