Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Constitutive expression promoter and application thereof

A technology of constitutive expression and promoter, applied in the field of plant biology

Inactive Publication Date: 2012-09-19
BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report that the KT632 gene is a constitutively expressed gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constitutive expression promoter and application thereof
  • Constitutive expression promoter and application thereof
  • Constitutive expression promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] The methods used in the following examples are conventional methods unless otherwise specified. The primers used were synthesized by Shanghai Yingjun Biotechnology Co., Ltd., and the sequencing was completed by Beijing Huada Gene. Zibao Bioengineering Co., Ltd., pEASY-T1 ligation kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd., and T4 DNA ligase was purchased from Promega Company. The methods were all carried out according to the methods provided in the kit. The carrier pHPG used in the experiment was transformed from this experiment, and the basic skeleton came from pCAMBIA1303 of CAMBIA Company.

[0029] 1. Isolation and Characterization of Promoter KT632P

[0030] Design the primers required for cloning the promoter KT632P:

[0031] Primer 1: 5'-ggatcc ATACAACAGGAGGACAACATCTGG -3'

[0032] Primer 2: 5'-gaattc GCTACAACTACAAGTGCAACTTACAA -3'

[0033] The sequence ggatcc in primer 1 is the restriction site for BamHI, and the sequence gaattc i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant biotechnology, and particularly relates to functional identification and application of a rice constitutive expression promoter KTN632P. A KT632 gene disclosed by the invention is a rice NAC type transcription factor family gene, so that the promoter thereof has very strong expression in tissues and organs such as roots, stems, leaves and flowers of plants, has very strong expressing activity under various abiotic stress treatment conditions, and has better application prospect in plant trasgenetic field.

Description

technical field [0001] The invention belongs to the field of plant biotechnology, and in particular relates to the functional identification and application of a rice constitutive expression promoter KT632P. Background technique [0002] The exogenous DNA sequence is linked to a specific promoter to promote expression in the plant host, and the choice of the promoter type determines the time and location of gene expression. Currently, some strong constitutive promoters are widely used in the field of agricultural biotechnology, such as CaMV 35S promoter and maize Ubiquitin-1 promoter (Battraw and Hall, 1990; Christensen et al. 1992). [0003] Plant-specific NAC transcription factors are numerous and widely distributed in terrestrial plants, constituting one of the largest transcription factor families (Duval et al., 2002; Ooka et al., 2003). The NAC family is named after the Petunia hybrida NAM (No Apical Meristem) and Arabidopsis thaliana ATAF1, ATAF2 and CUC2 (cup-shaped ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/113C12N15/63C12N1/15C12N1/19C12N1/21
Inventor 李早霞吴洁芳周君莉
Owner BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com