Vaccine for preventing and curing tumor
A technology for vaccines and tumors, applied in gene therapy, anti-tumor drugs, applications, etc., can solve problems such as no clinical response observed
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0195] Embodiments of the present invention will be further described below in conjunction with the accompanying drawings, but should not be construed as limiting the present invention. The protection scope of the present invention shall be determined by the contents described in the claims.
[0196] For the vaccine for preventing and treating tumors, the nucleotide sequence of the connected multi-epitope telomerase reverse transcriptase is as follows:
[0197] gaggagatcctggccaagt tcctgcactggctgatgagtacct tgacagacctccagccgtacatgcgacagttcgtggctcacctgctgcgtttggtggatgatttcttgttggtgacacctccggtgtacgccgagaccaagcacttcctctactcctggcaggtgtacggcttcgtgcgggcctgcctgcgccggaaactctttggggtcttgcggctgaagtgtcaccgccccggcctcctgggcgcctctgtgctgggcctggacgatatc。
[0198] For the preparation of the vaccine for preventing and treating tumors, the preparation method comprises the following process steps:
[0199] A. Selection of epitope sequence;
[0200] B, tandem connection of nucleotides of multi-epit...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com