Supercharge Your Innovation With Domain-Expert AI Agents!

Vaccine for preventing and curing tumor

A technology for vaccines and tumors, applied in gene therapy, anti-tumor drugs, applications, etc., can solve problems such as no clinical response observed

Inactive Publication Date: 2010-12-22
HEBEI MEDICAL UNIVERSITY
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In contrast, no clinical response was observed with the adoptive transfer of tumor-reactive CD8+ T cell clones alone, and these cells were no longer detectable in peripheral blood after two weeks

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine for preventing and curing tumor
  • Vaccine for preventing and curing tumor
  • Vaccine for preventing and curing tumor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0195] Embodiments of the present invention will be further described below in conjunction with the accompanying drawings, but should not be construed as limiting the present invention. The protection scope of the present invention shall be determined by the contents described in the claims.

[0196] For the vaccine for preventing and treating tumors, the nucleotide sequence of the connected multi-epitope telomerase reverse transcriptase is as follows:

[0197] gaggagatcctggccaagt tcctgcactggctgatgagtacct tgacagacctccagccgtacatgcgacagttcgtggctcacctgctgcgtttggtggatgatttcttgttggtgacacctccggtgtacgccgagaccaagcacttcctctactcctggcaggtgtacggcttcgtgcgggcctgcctgcgccggaaactctttggggtcttgcggctgaagtgtcaccgccccggcctcctgggcgcctctgtgctgggcctggacgatatc。

[0198] For the preparation of the vaccine for preventing and treating tumors, the preparation method comprises the following process steps:

[0199] A. Selection of epitope sequence;

[0200] B, tandem connection of nucleotides of multi-epit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to vaccine and preparation thereof, in particular to a vaccine for preventing and curing tumor and preparation thereof. The vaccine is prepared by steps of: choosing a telomerase reverse transcriptase epitope sequence, serially connecting nucleotides the telomerase reverse transcriptase with multi-epitope, preparing the DNA vaccine of the telomerase reverse transcriptase with multi-epitope, and preparing the multi-epitope vaccine of the telomerase reverse transcriptase with multi-epitope. The invention overcomes the shortcomings that a single peptide vaccine only has a clinical effect in several tumor patients. After the vaccine has an immune body, the epitope specific CD4+T cells and the CD8+T cells can be activated. Under the assistance of the Th1 cell factor excreted from the CD4+T cells, the CD8+CTL can kill the tumor cell presenting TERT so as to prevent and cure tumor.

Description

technical field [0001] The invention belongs to a vaccine and its preparation, in particular to a vaccine for preventing and treating tumors and its preparation. Background technique [0002] Tumor is the number one killer that seriously threatens human health. According to the WHO report, there are currently about 10 million new cancer patients and 6.6 million deaths worldwide every year. It is estimated that there will be 300 million new cases and 100 million deaths from the disease in the next 25 years. In my country, there are 1.6 million to 2 million new cases every year, and there are more than 3 million cancer patients, which are increasing at a rate of 3% and showing a younger trend. Surgery, radiotherapy and chemotherapy are the three traditional methods for treating malignant tumors. Due to the biological characteristics of malignant tumors, the above-mentioned treatment methods have certain limitations. With the development of immunology, molecular biology and gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/00A61K48/00A61P35/00C12N15/12
Inventor 曾瑞红吴丽娜
Owner HEBEI MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More