Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bridge molecule 1-siRNA interference sequence and fusion expression vector thereof

A technology of fusion expression and interference sequence, which is applied in the direction of DNA/RNA fragments, recombinant DNA technology, and the use of vectors to introduce foreign genetic materials.

Active Publication Date: 2009-10-21
TIANJIN MEDICAL UNIV CANCER HOSPITAL
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the molecular mechanism of invasion and invasion of malignant glioma has not been fully clarified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bridge molecule 1-siRNA interference sequence and fusion expression vector thereof
  • Bridge molecule 1-siRNA interference sequence and fusion expression vector thereof
  • Bridge molecule 1-siRNA interference sequence and fusion expression vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] 1. Sources of experimental materials:

[0020] Human malignant glioma cell line LN-229 was provided by the University of Texas MD Anderson Cancer Center, the chemotaxis chamber was purchased from Neuro Probe, EGF was purchased from Peprotech, intersectin1 antibody was from Abcam, and G418 was purchased from Invitrogen company.

[0021] 2. Design and synthesis of intersectin1-siRNA

[0022] Design specific intersectin1-siRNA based on the siRNA design software provided by Ambion on the Internet, and synthesize the following templates by Shanghai Gemma Pharmaceutical Technology Co., Ltd., with BamH I and Bbs I restriction sites at both ends, and siRNA action sites: 5'-GGCTGGCTTGGAGGAGAATTA-3'.

[0023] Query 1 GGCTGGCTTGGAGGAGAATTA 21

[0024] ||||||||||||||||||||||

[0025] Sbjct 2615 GGCTGGCTTGGAGGAGAATTA 2635

[0026] 2581 ggaatgggtg gatgaaagcc aaactggaga acccggctgg cttggaggag aattaaagg

[0027] 2641 aaagacaggg tggttccctg caaactatgc agagaaaatc ccagaaaat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a bridge molecule 1-siRNA interference sequence and a fusion expression vector thereof, and belongs to the technical field of biology. A fragment of synthesized bridge molecule 1-siRNA interference sequence can reduce the expression of bridge molecule 1 protein, and generate inhibiting effect on cellular infiltration and diffusion function participated by the bridge molecule 1 protein; and after transfecting a human glioma cell line, the bridge molecule 1-siRNA fusion expression vector can specifically degrade bridge molecules 1mRNA complemented with the fusion expression vector, inhibit in vitro migration capability and chemotactic capability of malignant glioma LN-229 cells, inhibit in vitro adhesive capability and invasion capability of the malignant glioma LN-229 cells, reduce infiltration and diffusion capabilities of tumor cells, and provide a feasible technological measure for gene therapy of tumor.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a bridge molecule 1-siRNA interference sequence and a fusion expression vector thereof for inhibiting glioma cell infiltration and spread. Background technique [0002] Post-transcriptional gene silencing is an evolutionary defense mechanism against transcriptomes and RNA viruses that arose before the divergence of plants and animals. In 1998, Andrew Fire of the Carnegie Research Institute of Washington and Craig Mello of the University of Massachusetts Cancer Center injected double-stranded dsRNA (double-stranded RNA) into nematodes for the first time, which induced gene silencing stronger than individual injections of the sense and antisense strands. This suppression of specific gene expression triggered by dsRNA is called RNA interference (RNA interference RNAi). [0003] RNA interference is sequence-specific gene silencing caused by double-stranded RNA, which is a very conserved...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/63A61K48/00A61P35/00C12N15/113
Inventor 马勇杰谷峰王冰冰牛瑞芳付丽
Owner TIANJIN MEDICAL UNIV CANCER HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com