Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit for Mycoplasma hyopneumoniae and use thereof

A Mycoplasma hyopneumoniae, one-to-one technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, microorganisms, etc., can solve the problems of expensive preparation of fluorescent probes, unsuitable for grassroots applications, etc.

Inactive Publication Date: 2009-07-15
CHINA AGRI UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The PCR method is fast and sensitive, but requires the use of special instruments, such as PCR machines, and the preparation of fluorescent probes is relatively expensive, which is not suitable for grassroots applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for Mycoplasma hyopneumoniae and use thereof
  • Detection kit for Mycoplasma hyopneumoniae and use thereof
  • Detection kit for Mycoplasma hyopneumoniae and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Embodiment 1, the preparation of Mycoplasma hyopneumoniae detection kit

[0061] 1. Synthesis of primers

[0062] Artificially synthesize the following 3 pairs of primers:

[0063] F3: AACATCTCACGACACGAG;

[0064] B3: GCTAACGCGTTAAATGATCC;

[0065] FIP: CTTACCCACTCTTGACATTCTCGTTTTCGACAACCATGCACCATC;

[0066] BIP: TAAACCACATGCTCCACCGCTTTTGCCTGAGTAGTATGCTCG;

[0067] LF:AGAGATATAGCCGAGGCTAACGAG;

[0068] LB: TGTGCGGGTTCCCGTCA.

[0069] 2. Preparation of sample tube

[0070] A small disc with a diameter of 2.0 mm was removed from a blank FTA card (Whatman, Cat No. WB120205) with a 2.0 mm perforated sampler, and placed at the bottom of a 0.25 ml centrifuge tube.

[0071] 3. Preparation of positive control

[0072] The 232 strains of Mycoplasma hyopneumoniae (China Veterinary Drug Administration) were diluted with normal saline and inoculated into healthy pigs. Two weeks later, the diseased lung was collected with aseptic technique, and the pathogen was isolated and...

Embodiment 2

[0077] Embodiment 2, the preparation of Mycoplasma hyopneumoniae detection kit

[0078] 1. Synthesis of primers

[0079] Same as Step 1 of Example 1.

[0080] 2. Preparation of sample tube

[0081] Same as Step 2 of Example 1.

[0082] 3. Preparation of positive control

[0083] Same as Step 3 of Example 1.

[0084] 4. Preparation of LAMP reaction solution

[0085] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , 0.025 μL Tween20, 20 μmol MgSO 4, 20μmol betaine (Betaine), 0.00125μmol calcein, 0.015μmol MnCl 2 , four deoxynucleotides (dNTPs) each 0.035umol, 0.06μmol upstream inner primer (FIP), 0.06μmol downstream inner primer (BIP), 0.008μmol upstream outer primer (F3), 0.008μmol downstream outer primer (B3), 0.04 μmol upstream circular primer (LF), 0.04 μmol downstream circular primer (LB), 8 U of Bst DNA polymerase, sterile double distilled water.

[0086] 5. Assembling the kit

[00...

Embodiment 3

[0088] Embodiment 3, the preparation of Mycoplasma hyopneumoniae detection kit

[0089] 1. Synthesis of primers

[0090] Same as Step 1 of Example 1.

[0091] 2. Preparation of sample tube

[0092] Same as Step 2 of Example 1.

[0093] 3. Preparation of positive control

[0094] Same as Step 3 of Example 1.

[0095] 4. Preparation of LAMP reaction solution

[0096] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , 0.025 μL Tween20, 10 μmol MgSO 4 , 20μmol betaine (Betaine), 0.00125μmol calcein, 0.015μmol MnCl 2 , four deoxynucleotides (dNTPs) each 0.035umol, 0.05μmol upstream inner primer (FIP), 0.05μmol downstream inner primer (BIP), 0.006μmol upstream outer primer (F3), 0.006μmol downstream outer primer (B3), 0.03 μmol upstream circular primer (LF), 0.03 μmol downstream circular primer (LB), 8 U of Bst DNA polymerase, sterile double distilled water.

[0097] 5. Assembling the kit

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Mycoplasma hyopneumoniae detection kit and the application thereof, and provides a special primer for detecting Mycoplasma hyopneumoniae. The special primer consists of following three pairs of primers used for loop-mediated isothermal amplification: one pair of primers is a medial primer pair combined with a 16S ribosomal RNA gene in Mycoplasma hyopneumoniae (GenBank Accession Number NC-006360), one pair of primers is a lateral primer pair combined with the 16S ribosomal RNA gene in Mycoplasma hyopneumoniae (GenBank Accession Number NC-006360), and one pair of primers is a ring primer pair combined with the 16S ribosomal RNA gene in Mycoplasma hyopneumoniae (GenBank Accession Number NC-006360). The detection kit provided by the invention is a kit including the special primer. The detection kit of the invention has the advantages of high detection sensitivity and simple and convenient operation; only ten copies are needed to detect a target DNA; and the detection kit is particularly suitable for detection of clinical medicine conducted in the base field and detection of Mycoplasma hyopneumoniae possibly polluted in food.

Description

technical field [0001] The invention relates to a detection kit for mycoplasma hyopneumoniae and its application. Background technique [0002] Mycoplasma swine pneumonia is a chronic respiratory infectious disease with high morbidity and low mortality in pigs caused by Mycoplasma hyopneumoniae. It is often called swine asthma (or panting disease) in my country. Mycoplasma swine pneumonia is widely distributed all over the world, and the infection rate in pig herds is 30%-80%. At present, most pig raising countries have reported the occurrence of this disease. After the onset, chronic dry cough may occur, long-term growth and development are poor, growth rate and feed conversion rate are reduced, and the general mortality rate is not high, but secondary infection can also cause serious death, resulting in great economic losses, which are harmful to the development of pig industry. It is one of the most frequently occurring and economically significant pig diseases. [0003...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11C12R1/01
Inventor 吴文学郭盼盼付萍
Owner CHINA AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More