Strict hypoxia targeting carrier and uses thereof
A technology of hypoxia response element and expression vector, applied in the fields of genetic engineering and pharmacy, which can solve problems such as loss of transcriptional response
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Construction of pVAX-HRE vector
[0021] Entrust a biological company to synthesize the HRE gene, its DNA sequence is as follows, with Sma I and Bgl II restriction sites at both ends:
[0022] CCCGGGCTGCAGGAATTCGATGCACGCGTCCGGGTAGCTGGCGTACGTGCTGCAACCGGGTAGCTGGCGTACGTGCTGCAGCCGGGTAGCTGGCGTACGTGCTGCAGCTCGAGACTTGACGCGTCCGGGTACCTGGCGTACGTGCTGCAGCCGGGTAGCTGGCGTACGTGCTGCAGCCGGGTATCTGGCGTACGTGCTGCAGCTCGAGACTTGACGCGTCCGGGTAGCTGGCGTACGTGCTGCAGCCGGGTAGCTGGCGTACGTGCTGCAGCCGGGTAGCTGGCGTACGTGCTGCAGCTCGAGATCT(SEQ ID NO:4)。
[0023] The fragments of vector pVAX and HRE were respectively taken, double-digested with Sma I and Bgl II, subjected to 1% and 2% gel electrophoresis respectively, and each fragment was recovered with a gel recovery kit. The pVAX vector fragment and the HRE fragment were mixed at a ratio of 1:3, added with T4 ligase, and reacted at 16°C for 16 hours, and the reaction product was transformed into competent E. Figure 1, Figure 2). Positive clones were ...
Embodiment 2
[0024] Example 2. Construction of pVAX-HRE-ODD vector
[0025] Entrust a biological company to synthesize the ODD gene, its DNA sequence is as follows, with HindIII and BamH I restriction sites at both ends:
[0026] AAGCTTATGAACCCATTTTCTACTCAGGACACAGATTTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACAGTATTCCAGGATCC (SEQ ID NO: 5).
[0027] The fragments of vector pVAX-HRE and ODD were respectively taken, and double-digested with Hind III and BamH I, and subjected to 1% and 2% gel electrophoresis respectively, and each fragment was recovered with a gel recovery kit. Mix the pVAX-HRE vector fragment and the ODD fragment at a ratio of 1:3, add T4 ligase, react at 16°C for 16 hours, transform the reaction product into competent E. Identification (Figure 3). Positive clones were named pVAX-HRE-ODD.
Embodiment 3
[0028] Example 3. Construction of pVAX-HRE-ODD-EGFP vector
[0029] Using pEGFP-N1 as template, EGFP-P1: 5'GCAGGATCCATGGTGAGCAAGGGCGAGGA3' (SEQ ID NO: 6); EGFP-P2: 5'GCAGCGGCCGCTTACTTGTACAGCTCGTCCA3' (SEQ ID NO: 7) as primer, PCR reaction was carried out for 30 cycles, after 1 % Gel electrophoresis, and the PCR fragment of EGFP was recovered with a gel recovery kit.
[0030] Take the PCR fragments of the vectors pVAX, pVAX-HRE, pVAX-HRE-ODD and EGFP respectively, carry out double digestion with BamH I and Not I, perform 1% gel electrophoresis, and recover pVAX and pVAX- HRE, pVAX-HRE-ODD and EGFP fragments. Mix pVAX, pVAX-HRE, pVAX-HRE-ODD vector fragments and EGFP fragments at a ratio of 1:3, add T4 ligase, react at 16°C for 16 hours, transform the reaction products into competent Escherichia coli DH5a, pick Successfully transformed colonies were identified by plasmid digestion (Figure 4). Positive clones were named pVAX-EGFP, pVAX-HRE-EGFP, pVAX-HRE-ODD-EGFP, respectively...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap