Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant acid-resistant yeast with suppressed glycerol production and method of producing lactic acid using the same

A technology of acid-resistant yeast and glycerin, applied in the direction of microorganism-based methods, biochemical equipment and methods, chemical instruments and methods, etc., can solve the problems of unreasonable and difficult to predict the effect of reducing the production cost of the process, so as to improve the conversion rate , Inhibit the effect of cross-linking

Pending Publication Date: 2021-10-22
SK INNOVATION CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Although the technology of producing lactic acid using acid-tolerant yeast has been developed, in practice, since this technology is in many cases accompanied by a neutralization reaction during fermentation, only when the pH value is maintained at at least 3.7 (not lower than the pKa value) in order to show higher fermentation performance, so it is unreasonable to determine this technology as a practical method to achieve acid resistance, and it is difficult to expect the effect of reducing the production cost in the process (Michael Sauer et al. al., Biotechnology and Genetic Engineering Reviews, 27:229-256, 2010)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant acid-resistant yeast with suppressed glycerol production and method of producing lactic acid using the same
  • Recombinant acid-resistant yeast with suppressed glycerol production and method of producing lactic acid using the same
  • Recombinant acid-resistant yeast with suppressed glycerol production and method of producing lactic acid using the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1: Analysis of glycerol-producing genes in the genome of acid-tolerant strain YBC

[0070] The present inventors selected strains having acid resistance by testing various yeast strains, and determined that they had the best acid resistance by adding lactic acid to the medium at the beginning of the culture of the yeast strains and monitoring the growth and sugar consumption rate of the microorganisms. The strain, namely the YBC strain, was deposited in the Bioresource Center of the Korea Institute of Bioscience and Biotechnology with the accession number KCTC13508BP.

[0071] Phylogenetic analysis showed that the YBC strain (KCTC13508BP) is a strain similar to S. cerevisiae, is diploid, and is Crabtree positive.

[0072] Using bioinformatic information from Saccharomyces cerevisiae and whole genome sequence data from this YBC strain, g1544 and g5617 were identified as genes annotated with GPD1 (glycerol-3-phosphate dehydrogenase 1) and GPD2, respectively, which...

Embodiment 2

[0080] Embodiment 2: the mensuration of GPD gene expression level

[0081] In order to confirm the expression levels of GPD1 (g1544) and GPD2 (g5617) of this YBC strain, RT-qPCR was performed using the following primers and the ALG9 gene as a housekeeping gene. The RT-qPCR method used in this example will be described as follows. RNA was extracted from the YBC strain during logarithmic growth, and cDNA was generated using the RNA as a template. Specific primers for each of the target genes (GPD1 and GPD2) and housekeeping genes (used as Ref genes) were synthesized and used for qPCR. The Ref gene used in the experiment was ALG9, and the size of the fragment amplified by the primers used was 147±3bp.

[0082] ALG9 forward primer: CTTTGAGTGCAAGTATCGCC (SEQ ID NO: 22)

[0083] ALG9 reverse primer: TGTGTAATTGTTCACCAAAGCC (SEQ ID NO: 23)

[0084] GPD1 (g1544) forward primer: GTCGATTCTCATGTTCGTGC (SEQ ID NO: 24)

[0085] GPD1 reverse primer: CTTAGCGACTTCAGTAGCGA (SEQ ID NO: 25) ...

Embodiment 3

[0090] Embodiment 3: the construction of the recombinant acid-resistant yeast strain that has deleted GPD gene

[0091]The g1544 gene, g5617 gene, g5443 gene and g4356 gene annotated with GPD1 gene, GPD2 gene, GPP1v1 gene and GPP1 v2 gene, respectively, were removed from the genome of this YBC strain to construct a strain.

[0092] The acid-resistant yeast strain used for the gene removal was the YBC1 strain constructed by introducing the LDH gene into this conventional YBC strain (instead of the YBC wild-type strain) and deleting ADH (alcohol dehydrogenase) therefrom, whereby, by introducing the LDH gene from the YBC1 The g3002-1 gene (PDC gene) was removed from the strain and LDH was introduced into it to construct a YBC2 strain capable of efficiently producing lactic acid and inhibiting ethanol production, and the YBC4 strain whose lactic acid consumption ability was removed was introduced into the strain by introducing the LDH gene and removing the lactic acid consumption ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed are a recombinant acid-resistant yeast having lactic acid-producing ability and suppressed glycerol production and a method of preparing lactic acid using the same. More particularly, disclosed are a recombinant acid-resistant yeast into which a gene involved in lactic acid production is introduced and in which a gene involved in glycerol production is deleted or attenuated, and a method of preparing lactic acid using the same. When producing lactic acid using the recombinant acid-resistant yeast, the production of lactic acid is maintained while the production of glycerol is reduced, so crosslinking by glycerol can be suppressed in the oligomerization reaction for conversion to lactide, and thus the conversion yield of lactic acid to lactide can be increased.

Description

technical field [0001] The invention relates to a recombinant acid-tolerant yeast with lactic acid production ability and suppressed glycerin production and a method for preparing lactic acid using the same. More specifically, the present invention relates to a recombinant acid-tolerant yeast in which a gene involved in lactic acid production is introduced and a gene involved in glycerol production is deleted or attenuated, and a method for producing lactic acid using the recombinant acid-tolerant yeast. Background technique [0002] Polylactic acid (PLA) is a biodegradable polymer prepared by converting lactic acid into lactide and subjecting it to ring-opening polymerization. Its raw material, lactic acid, is produced by fermentation. Widely used in disposable food containers, PLA has the advantage that it can be used alone or in the form of compositions or copolymers in plastics in various industries, including the automotive industry and the fiber industry. In addition...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12P7/56C12N9/04C12N15/53C12N15/60C12N15/113
CPCC12N15/52C12N9/0006C12N9/88C12N9/0008C12P7/56C12Y101/01027C12Y101/01028C12Y101/01001C12Y401/01001C12Y101/01008C12Y102/02003C07K14/39C12R2001/865C12N15/81C07K14/001C12N15/11C12Y101/05003
Inventor 朴宰演李气成李泰荣
Owner SK INNOVATION CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com