Preparation method of capillary sensor based on capillarity and application thereof
A capillary phenomenon, capillary technology, applied in the field of biosensors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0029] (1) Aminated mesoporous silica (MSN-NH 2 ) to load FS-31
[0030] MSN-NH 2 Ultrasonic dispersion in 0.1% FS-31, after shaking for 24 h, the MSN-NH loaded with FS-31 was obtained 2 ;
[0031] (2) Capping of nucleic acid aptamers
[0032] In order to realize the detection of mercury ions, we choose the nucleic acid adapter DNA strand corresponding to mercury ions: TTTTTTTTTTTTTTTTTTTT, with a length of 20 T bases; take 10.0 μg / mL MSN-NH loaded with FS-31 in (1) 2 , add 2.5 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 5 minutes, place in a constant temperature water bath at 37°C for 3 hours, then add 200 μL of ethanol, shake fully, centrifuge, wash with ethanol, and finally put it in a vacuum at 37°C. Dry in oven for 20 min;
[0033] (3) Modification of capillary
[0034] Absorb the clean capillary with 1% PDDA aqueous solution obliquely, seal it with plastic wrap, place it for adsorption at room temperature for 30 ...
Embodiment 2
[0038] (1) Aminated mesoporous silica (MSN-NH 2 ) to load the FS-300
[0039] MSN-NH 2 Ultrasonic dispersion in 0.3% FS-300, after shaking for 30 h, the MSN-NH loaded with FS-300 2 ;
[0040] (2) Capping of nucleic acid aptamers
[0041] In order to realize the detection of ATP, we choose the aptamer DNA chain corresponding to ATP: ACCTGGGGGAGTATTGCGGAGGAAGGT, with a length of 27 bases; take 5.0 μg / mLMSN-NH loaded with FS-300 in (1) 2 , add 4.0 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 5 minutes, place in a constant temperature water bath at 37°C for 3 hours, then add 500 μL of ethanol, shake fully, centrifuge, wash with ethanol, and finally put it in 40°C for vacuum drying Oven drying for 10min;
[0042] (3) Modification of capillary
[0043] Absorb the clean capillary obliquely with 0.1% PDADMAC aqueous solution, place it for adsorption at room temperature for 30 min, and blow dry with high-purity nitrogen gas to o...
Embodiment 3
[0047] (1) Aminated mesoporous silica (MSN-NH 2 ) to load FS-31
[0048] MSN-NH 2 Ultrasonic dispersion in 0.3% FS-31, after shaking for 24 h, the MSN-NH loaded with FS-31 was obtained 2 ;
[0049] (2) Capping of nucleic acid aptamers
[0050] In order to realize the detection of prostate-specific antigen (PSA), we selected the aptamer DNA chain corresponding to PSA: TTTTTAATTAAAGCTCGCCATCAAATAGCTTT, with a length of 32 bases; 10.0 μg / mL of FS-31 loaded in (1) MSN-NH 2 , add 2.5 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 10 min, place in a constant temperature water bath at 45°C for 1.5 h, then add 500 μL of 40% methanol solution to wash by centrifugation, and dry in a vacuum oven at 45°C for 10 min. , to obtain the MSN-NH of DNA capping FS-31 2 ;
[0051] (3) Modification of capillary
[0052] Absorb the clean capillary obliquely with 0.3% PDADMAC aqueous solution, place it for adsorption at room temperature for 30...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com