Molecular marker C98284 for rapidly identifying hereditary characters of cherax quadricarinatus and application of molecular marker C98284
A technology of C98284F and C98284R is applied in the field of molecular marker C98284 for rapid identification of the genetic sex of red crayfish, and achieves the effects of high accuracy, low requirements, and simple and quick sex identification.
Active Publication Date: 2021-01-15
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI +1
View PDF1 Cites 4 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
At present, there is no research or report on the sex molecular markers of red crayfish. Therefore, the development of molecular markers related to the sex identification of re...
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0020] 1. DNA extraction
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more PUM
Login to view more
Abstract
The invention provides a molecular marker C98284 for rapidly identifying hereditary sex of cherax quadricarinatus and application of the molecular marker C98284. The nucleotide sequence of the molecular marker C98284 is shown as SEQ ID No.1, the nucleotide sequence of a primer pair for detecting the molecular marker C98284 is a forward sequence C98284F: TAACACCGAGCACCGACATTT, and a reverse sequence C98284R: TTGTTCACGCTACAGTGTTCCG. The molecular marker C98284 provided by the invention is not influenced by the tissue specificity and environment of the cherax quadricarinatus, and is simple to use; the molecular marker not only can quickly and efficiently identify the genetic sex of the cherax quadricarinatus, but also can promote the establishment of a cherax quadricarinatus all-female or high-female fry breeding technology, and has a wide application prospect.
Description
technical field [0001] The invention belongs to the technical field of DNA molecular markers, and in particular relates to a molecular marker C98284 for quickly identifying the genetic sex of crayfish and its application. Background technique [0002] Red-clawed crayfish (Cherax quadricarinatus) belongs to the phylum Arthropoda, Crustacea, Decapod order, and Crayfish family. It is one of the most valuable freshwater economic shrimp species in the world. Red-clawed crayfish has the breeding advantages of large individual, miscellaneous food habits, fast growth, few diseases and strong adaptability. Because of its high ratio of edible parts, delicious meat and high nutritional value, red claw shrimp is widely welcomed in Europe and the United States, and its market prospect is relatively broad. During the breeding process, male shrimps fight fiercely due to snatching mating rights, resulting in high mortality. If efficient parthenoculture can be realized, the breeding efficie...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more Application Information
Patent Timeline
Login to view more
IPC IPC(8): C12Q1/6879C12Q1/6858C12N15/11
CPCC12Q1/6879C12Q1/6858C12Q2600/156C12Q2600/124C12Q2565/125C12Q2531/113
Inventor 金玲李色东吕建建陈奕彬刘萍李健
Owner YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Try Eureka
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap