Rapid full-length amplicon library building method suitable for PacBio platform, universal primer and sequencing method
A universal primer and amplicon library technology, which is applied in the field of universal primers and full-length amplicon sequencing based on the library construction method, can solve the problems of accurate identification and classification of difficult species, achieve cost saving, simplify the construction process, The effect of improving the efficiency of database construction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] For full-length 18S full-length sequencing, the specific operation process of an embodiment is as follows:
[0041] 1. Amplify the full-length target fragment of each sample
[0042] 1. Artificially synthesized PCR universal primers with barcode tag sequence and universal binding sequence
[0043] A total of 24 PCR primers were synthesized for the full-length 18S DNA samples of 12 fungal samples (derived from distiller's lees fermentation residue), and their DNA sequences are as follows:
[0044] SEQ ID No. 1, NS1F-1-T: gcggccgcatcgctctcatgtctagtagtcatatgcttgtctc
[0045] SEQ ID No. 2, NS1F-2-T: gcggccgcacgatgtatctacgcagtagtcatatgcttgtctc
[0046] SEQ ID No. 3, NS1F-3-T: gcggccgctcgatacgcactcgatgtagtcatatgcttgtctc
[0047] SEQ ID No. 4, NS1F-4-T: gcggccgccacgacacgacgatgtgtagtcatatgcttgtctc
[0048] SEQ ID No. 5, NS1F-5-T: gcggccgcctgcagctcactactagtagtagtcatatgcttgtctc
[0049] SEQ ID No. 6, NS1F-6-T: gcggccgcctatatgagacgagtggtagtcatatgcttgtctc
[0050] SEQ ID No. ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com