Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of rice cyc U2;1 gene in controlling rice mesocotyl development

A rice and hypocotyl technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased seedling emergence rate, decreased yield, difficulty in emergence of rice seed top soil, etc.

Active Publication Date: 2021-09-07
HUAZHONG AGRI UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, direct seeding of rice also has its limitations, because the increase in the depth of direct seeding seeds in the soil will make it more difficult for rice seeds to emerge from the top of the soil, thereby reducing the emergence rate and yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice cyc U2;1 gene in controlling rice mesocotyl development
  • Application of rice cyc U2;1 gene in controlling rice mesocotyl development
  • Application of rice cyc U2;1 gene in controlling rice mesocotyl development

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Acquisition of a gene CYC U2;1 controlling rice mesocotyl development:

[0023] The inventor cloned CYC U2; 1 from rice mesocotyls by means of reverse genetics, and used Real-time PCT to verify the specific expression of CYCU2; 1 in the mesocotyl. The specific steps include:

[0024] Cloning of gene CYC U2;1:

[0025] The total volume of the reaction system is 50 μl, the template is Nipponbare cDNA 1ul (about 50ng), 10×KOD enzyme reaction buffer 5μl, 25mM MgCL 2 2μl, 5mM dNTP 5μl, 5uM primer 5μl (by step PCR method, use primers CYC U2-1306-F and CYC U2-1306-R (each primer is 2.5μl), 1μl KOD enzyme, add ddH 2 O (sterile deionized water) to 50 μl.

[0026] The reaction program was: denaturation at 94°C for 5min, 30s at 94°C, 1min at 55°C, 35cycles at 68°C for 2min, and extension at 68°C for 10min.

[0027] The primers used are as follows:

[0028] CYC U2-1306-F: CGGGATCCATGGCGTCCACTGAGTTAGCGTCGG

[0029] CYC U2-1306-R:GCTCTAGACTGGGCTGCCGCCGACGCCGCTTGC

[0030] Fina...

Embodiment 2

[0034] The application of CYC U2; 1 gene in controlling rice mesocotyl, the application process is as follows:

[0035] 1) Construction of plant expression vector pCYCU2; 1-GUS

[0036] Amplify the CYC U2;1 promoter region and clone the fragment into pCAMBIA1300GNGUS using the MfeI / KpnI restriction site (Ren Z H, Gao J P, Li L G, et al. A rice quantitative trait locus for salttolerance encodes a sodium transporter[J] .Nature genetics, 2005,37(10):1141-1146.) on the carrier.

[0037] The CYC U2; 1 promoter region is obtained in the following manner:

[0038] The total volume of the reaction system is 50 μl, the template is Nipponbare Genomic DNA 1ul (about 50ng), 1×KOD enzyme reaction buffer 5μl, 25mM MgCL 2 2μl, 5mM dNTP 5μl, 5uM primer 5μl (primers CYC U2Pro-F and CYC U2Pro-R respectively 2.5μl), 1μl KOD enzyme, add ddH 2O (sterile deionized water) to 50 μl. The reaction program was: denaturation at 94°C for 5min, 30s at 94°C, 1min at 55°C, 35cycles at 68°C for 2min, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering and discloses the application of rice CYC U2; 1 gene in controlling the development of rice mesocotyls. The applicant found that CYC U2;1 ( Os04g46660 ) is specifically expressed in rice mesocotyls, its CDS sequence is shown in SEQ ID NO.2, and the encoded amino acid sequence is shown in SEQ ID NO.3. The present invention also provides the promoter sequence of the gene, which is shown in SEQ ID NO.1. The promoter and full-length CDS of CYC U2;1 were cloned into pCAMBIA1301, and transformed into Nipponbare. The obtained transgenic lines showed that the mesocotyl length was longer than that of the wild type, so the genetic engineering technology improved or weakened the mesocotyl. CYC U2;1 The expression level of the gene can control the development of the mesocotyl of the plant, thereby improving the plant structure and improving the unearthing ability of the seed after direct seeding.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to the application of rice CYC U2;1 gene in controlling the development of rice mesocotyls, using the method of reverse genetics to screen out CYC U2;1 specifically expressed in mesocotyls, using the pCYCU 2-GUS transgenic line to prove CYC The promoter of U2;1 is specifically expressed at the mesocotyl; the expression of CYC U2;1 was increased by transgenic and the expression of CYC U2;1 was reduced by RNAi technology, which proves that the CYC U2;1 gene controls the development of rice mesocotyl Gene. Background technique [0002] The hypocotyl is an important phenotype in the development of plant seeds and seedlings. The hypocotyl of plants can be divided into epicotyl, mesocotyl and hypocotyl from top to bottom. The epicotyl usually refers to the part from the germ to the coleoptile node, the mesocotyl usually refers to the part between the coleoptile node an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8267
Inventor 王学路孙世勇王涛
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com