New application of motherwort
A technology of motherwort and its uses, applied in the direction of medical preparations containing active ingredients, pharmaceutical formulas, metabolic diseases, etc., can solve problems such as unclear mechanism of action, active ingredients of drugs, unclear active parts, and insufficient research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Experimental method:
[0030] 1. Design paired probes for genes: design paired probes for the junction sequences of two adjacent exons of the selected gene to avoid contamination of the genome.
[0031]2. Cells treated with 20 kinds of traditional Chinese medicine extracts: HepG2 cells were purchased from Union College of Basic Medical Sciences, Chinese Academy of Medical Sciences, cultured in DMEM medium containing 10% fetal bovine serum, and cultured at a constant temperature of 37°C. Cells with logarithmic growth were selected and seeded in 384-well plates, each well containing 3000 cells and 80 μL of medium. After incubation at 37°C for 24 hours. Quantitatively add 0.4 μL motherwort with a concentration of 25mg / mL in the cell culture well, motherwort boy, Rhizoma chinensis, Spatholobus, Rhizoma Polygonatum, Ophiopogon japonicus, Kunming Spatholobus, Gentian, Vitex unifolia, lentils, Extracts of Patrinia alba, Prunella vulgaris, Prunella lanceolata, Scallop, Pat...
Embodiment 2
[0046] Use the real-time quantitative gene amplification fluorescence detection system, that is, the qPCR method to verify the expression of HMGCR, LDLR, and HMGCS1 genes, and at the same time verify Motherwort. The specific experimental process is as follows:
[0047] 1. The cells were treated with the extracts of motherwort and motherwort respectively.
[0048] 2. Use the kit to extract RNA and reverse to cDNA.
[0049] 3. RT-qPCR reaction, program: 95°C, 3min; (95°C, 3s; 60°C, 30s) 40 cycles.
[0050] Among them, the primer sequence is:
[0051] HMGCR: upstream primer TGATTGACCTTTCCAGAGCAAG,
[0052] downstream primer TGATTGACCTTTCCAGAGCAAG;
[0053] LDLR: upstream primer ACCAACGAATGCTTGGACAAC,
[0054] downstream primer ACAGGCACTCGTAGCCGAT;
[0055] HMGCS1: upstream primer CATTAGACCGCTGCTATTCTGTC,
[0056] downstream primer TTCAGCAACATCCGAGCTAGA;
[0057] 4. Data processing: the gene expression level of the blank control group was regarded as 1, and the gene express...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com