Detection method and application of map7 expression level in cn-aml tissue samples

A technology that uses and binds proteins. It is applied in DNA/RNA fragments, biochemical equipment and methods, and the determination/examination of microorganisms. It can solve problems such as intensive treatment of patients, recurrence of leukemia, and poor prognosis.

Active Publication Date: 2019-11-15
PEKING UNIV THIRD HOSPITAL
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, CN-AML patients are a group of highly heterogeneous internal prognosis, and lack the characteristic chromosomes for judging prognosis. Therefore, the stratified diagnosis and individualized treatment of CN-AML are very difficult in clinical practice, and it is urgent to find effective Prognostic markers to confirm the intensity of treatment for such patients, so as to achieve precise individualized treatment, avoid excessive treatment intensity for some patients with good prognosis, which will bring many unnecessary complications, and also avoid other patients with poor prognosis Inadequate treatment, which eventually leads to relapse of leukemia
[0003] In the prior art, CN-AML does not have genetic markers for judging its clinical prognosis at the chromosomal level, but there are pathogenic gene mutations in some CN-AML, and these gene mutations have the function of risk stratification and Prognostic value of clinical judgment, such as carrying FLT3-ITD (see WHITMAN S P, MAHARRY K, RADMACHER M D, et al. FLT3 internal tandem duplication associates with adverse outcome and gene-and microRNA-expression signatures in patients 60 years of age or olderwith primary cytogenetically Normal acute myeloid leukemia:a Cancer and Leukemia Group B study[J].Blood,2010,116(18):3622-6) CN-AML patients have poor prognosis, and carry NPM1 mutation (see DOHNER K, SCHLENK R F, HABDANK M, et al. Mutant nucleophosmin (NMP1) predicts favorable prognosis in younger adults with acute myeloidleukemia and normal cytogenetics: interaction with other gene mutation [J]. Blood, 2005, 106 (12): 3740-6), CEBPA double mutation ( See PASTORE F, KLING D, HOSTER E, et al. Long-term follow-up of cytogenetically normal CEBPA-mutated AML [J]. Journal of hematology & oncology, 2014, 7) patients have a relatively good prognosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and application of map7 expression level in cn-aml tissue samples
  • Detection method and application of map7 expression level in cn-aml tissue samples
  • Detection method and application of map7 expression level in cn-aml tissue samples

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] The extraction of embodiment 1 total RNA

[0090] During the experimental operation, micropipettes, Tips, and EP tubes related to RNA extraction and detection must be treated without RNase.

[0091] 1. Cell lysis: Add 1ml of QIAZOL reagent to the collected cell pellet, shake and mix with an oscillator, and let it work at room temperature for more than 15 minutes to fully lyse it. If RNA cannot be extracted immediately after adding QIAZOL reagent, it can be stored at -20°C and can be used in a short time.

[0092] 2. According to the volume ratio of chloroform: QIAZOL 1:4, add about 300 μl chloroform, mix upside down for 1 minute, let stand at room temperature for 5-10 minutes, and centrifuge at 4°C, 12600rpm for 10 minutes.

[0093] 3. After centrifugation, the liquid in the EP tube is divided into three layers, the upper layer is the supernatant containing RNA, and the middle and lower layers are DNA and protein. Then, transfer the supernatant to a new EP tube, add a...

Embodiment 2

[0097] Example 2 RNA reverse transcription

[0098] 1. Prepare the reverse transcription system according to Table 1, the total reaction volume is 25 μl (total RNA amount is 1 μg). The following operations were performed on ice:

[0099] Table 1 Preparation of reverse transcription system

[0100]

[0101] 2. After preparing the above reaction components into 0.2ml PCR reaction tubes, put them into a PCR instrument for reverse transcription reaction. The program is 37°C, 2h; 4°C, forever. The product obtained after the reaction is cDNA, and the reaction product is taken out and stored at -20°C until use.

Embodiment 3

[0102] Embodiment 3 real-time fluorescent quantitative PCR detection

[0103] 1. Prepare real time PCR mix according to Table 2.

[0104] 2. In the reaction tube, prepare 2 times the volume of 2×SYBR GreenⅠ, Nuclease-free water, template cDNA and ROXⅡ mixture, mix well and divide into two 0.2ml PCR reaction tubes, and then add the target gene SEQ ID NO : 1 primer for SEQ ID NO: 2 and 3 or internal reference GAPDH (glyceraldehyde-3-phosphate dehydrogenase, glyceraldehyde-3-phosphate dehydrogenase) primer, gently mixed.

[0105] 3. Put the reaction tube into a real-time fluorescent quantitative PCR instrument for PCR amplification. The reaction program is 95°C, 1 minute; 95°C, 5s; 60°C, 20s; a total of 40 cycles. Then 95°C, 1 minute; 60°C, 1 minute, 95°C, 30s. The fluorescence collection point was at 60° C., and the PCR product SEQ ID NO: 4 was taken out after the reaction was completed.

[0106] 4. Statistical analysis was performed on the obtained data, and GAPDH was used a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for detecting the expression level of MAP7 in a CN-AML tissue sample and an application thereof. The invention provides primer pairs of a microtubule-associated protein 7 gene, wherein the sequences of one primer pair are tcctgggagctgcaattaca (SEQ ID NO:2) and gggtgcttttggtcttctgg (SEQ ID NO:3) or complementary sequences thereof. In the invention, the primer pairs are used for performing risk stratification or clinical prognosis evaluation for patients suffering normal karyotype acute myelogenous leukemia by detecting the expression level of microtubule-associated protein 7. The invention also provides a gene chip and a kit comprising the primer pairs.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the detection, risk stratification and clinical prognosis evaluation of normal karyotype acute myeloid leukemia genes, in particular to detection primers, gene chips and kits for normal karyotype acute myeloid leukemia genes. Background technique [0002] Acute myeloid leukemia (acute myeloid leukemia, AML) is a highly heterogeneous malignant blood disease, accounting for about 80% of adult acute leukemia (see MROZEK K, HEEREMA N A, BLOOMFIELD C D., Cytogenetics in acute leukemia[ J]. Blood reviews, 2004, 18(2): 115-36), which includes many entities with different genetic abnormalities and clinical features, and the prognosis is highly heterogeneous. Chromosomal translocation is the most common diagnostic and prognostic marker, but about half of the patients in CN-AML have no chromosomal abnormality, which is called cytogenetically normal acute myeloid leukemia (CN-AML). In the NCCN (N...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/112C12Q2600/118C12Q2600/136
Inventor 石金龙付林付华平徐克曼王晶克晓燕
Owner PEKING UNIV THIRD HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap