Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel purpose of microRNA-30 family

A family and role technology, applied in the new application field of the microRNA-30 family, which can solve the problem of unclear proteinuria and other problems

Active Publication Date: 2014-12-10
KIDNEY DISEASES INST P L A
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The podocyte-specific Dicer / Drosha knockout mouse model also strongly proves that microRNA is indispensable for maintaining the normal function of podocytes, but it is still unclear which podocyte microRNA loss leads to proteinuria.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel purpose of microRNA-30 family
  • Novel purpose of microRNA-30 family
  • Novel purpose of microRNA-30 family

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Application of microRNA30 family as podocyte injury markers in patients with focal segmental glomerulosclerosis (FSGS)

[0032] The microRNA-30 family is one of the important components of microRNAs. The human and mouse microRNA-30 families include five members: microRNA-30a, microRNA-30b, microRNA-30c, microRNA-30d, and microRNA-30e. The five members of the microRNA-30 family are all expressed in podocytes (human, rat, mouse) and are abundant. In the application of the microRNA30 family as a marker of podocyte injury in patients with focal segmental glomerulosclerosis (FSGS), the specific detection methods are:

[0033] (1) In situ hybridization

[0034] Kidney tissue paraffin specimens were freshly prepared for xylene dewaxing, dehydrated with graded alcohol, and freshly prepared with 0.5% H 2 o 2 Treat at room temperature for 30 minutes to inactivate endogenous peroxidase; freshly prepare protease (0.01g / L) with 3% citric acid, and treat at 37°C for 10 m...

Embodiment 2

[0038] Example 2 The new application of the microRNA-30 family in the preparation of podocyte therapeutic drugs

[0039] (1) Plasmid transfection method

[0040] 1) MicroRNA-30a plasmid construction: ① Gene sequence synthesis: use pSilencer2.0U6 plasmid as a carrier, synthesize microRNA-30a sequence by PCR method, and add BamHI restriction site (GATCC) at the 5' end, and add HindⅢ ( A) Restriction site, and add 5 Ts as the terminator of RNA polymerase III, the final synthesized sequence is

[0041] gatccgcgactgtaaacatcctcgactggaagctgtgaagccacagatgggctttcagtcggatgtttgcagctgcttttta and simultaneously synthesized microRNA30a reverse complementary pairing sequence gtaaaaagcagctgcaaacatccgactgaaagcccatctgtggcttcacagcttccagtcgaggatgtttacagtcgcggatcttcga. ②Use a PCR instrument to anneal and ligate the above-mentioned single-stranded oligonucleotide fragments; ③The vector pSilencer2.0U6 plasmid is linearized and recovered: add the vector pSilencer2.0U6 plasmid (10 μl), BamHI enzyme (...

Embodiment 3

[0049] Embodiment three plasmid animal experiments

[0050] Injection method of microRNA-30a plasmid in rat tail vein:

[0051] (1) MicroRNA-30a plasmid preparation (the method is the same as the plasmid transfection method in Example 2).

[0052] (2) Tail vein injection of microRNA-30a plasmid: the specific operation is as follows. Wistar rats were anesthetized without anesthesia or 10% chloral hydrate (dose 3ml / Kg), and injected 80ml / kg into the tail vein with a 24G intravenous trocar Ringer's solution (containing 100 μg plasmid encoding microRNA-30a gene), the injection was completed within 10 seconds.

[0053] The result is as Figure 4 As shown, the microRNA-30a plasmid treatment can significantly reduce the 24-hour proteinuria of PAN rats, and the proteinuria of the rats was significantly increased by 117±53mg on the 5th day, 7th day, and 9th day after PAN (5mg / 100g) injection / 24h, 182±75, 235±60, after microRNA-30a plasmid tail vein injection on the 5th day, 7th day...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel purpose of a microRNA-30 family, and concretely to an application of the family used as a podocyte injury marker for patients with focal segmental glomerulosclerosis (FSGS). In addition, the invention further provides an application of the microRNA-30 family in preparation of medicaments for treating the podocyte injury. According to the invention, the microRNA-30 family facilitates diagnosis for the patients with the focal segmental glomerulosclerosis (FSGS) and the preparation of the medicaments for treating the podocyte injury, and thus has an extremely important significance for diagnosis and treatment of chronic kidney diseases.

Description

technical field [0001] The invention relates to the field of genetic biological preparations, in particular to the new application of the microRNA-30 family. Background technique [0002] Chronic kidney disease (CKD) has become one of the important diseases threatening the health of our population. With the increase in the incidence of diabetes, obesity, hypertension and population aging in China, the incidence of CKD will continue to increase. Therefore, elucidating the mechanism of occurrence and development of chronic kidney disease and its intervention measures is the key to improving the level of early warning, early diagnosis and early treatment of CKD. [0003] Podocyte injury is the central link in the occurrence and development of kidney diseases. Podocytes are glomerular visceral epithelial cells, which are the largest and most complex innate cells in the glomerulus. They are also the only highly terminally differentiated cells in the glomerulus. They attach to t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/113A61K48/00A61P13/12
Inventor 吴俊男刘志红施少林
Owner KIDNEY DISEASES INST P L A
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com