Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construct and application thereof

A technology of constructs and receptors, applied in the field of bioengineering, can solve problems such as limited genetic resources and needs to be improved, and achieve the effect of improving efficiency

Inactive Publication Date: 2013-08-07
SHENZHEN HUADA GENE INST +2
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the genetic resources that can be used by conventional breeding are very limited. To obtain better strains or varieties with high light efficiency, it is necessary to introduce excellent genetic resources through modern biotechnology, especially molecular breeding technology, so as to create high light efficiency germplasm.
[0003] With the continuous maturity and improvement of gene sequencing, molecular breeding technology, and transgenic technology, screening and excavation of genes related to photosynthetic efficiency and yield, and using the genes for genetic transformation to obtain high-light-efficiency plants and germplasm have been realized. However, the above Research still needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construct and application thereof
  • Construct and application thereof
  • Construct and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Construct Preparation

[0062] 1. Synthesis of cyanobacteria ictB gene and construction of vector pUC57-ictB

[0063] The inventor commissioned Sangon Bioengineering Co., Ltd. to synthesize the cyanobacteria ictB gene (SEQ ID NO: 1), and added restriction enzyme sites BamHI and XbaI to the upstream and downstream of the synthetic gene, in order to obtain the following: Shown in SEQ ID NO: 2 Nucleic acid sequence, and connected to the vector pUC57, so as to obtain the pUC57-ictB vector.

[0064] GGATCC ACCATGGCTGAGGCTTCAGAACCGTCTCCATGGTTGCTGCGCTGGCAAG GATGTCTCCCCAGCTCGGCAGCCCAACAAAAGCGCCTCGCCAATCTGGCCGGCATTGT TTTGATCCTCCTGCTTGCAGGACTGCCCCTGGTGACGCGCACGGGGCTGGGACTGATC GTGCTGGCGTGTGGTGCGCTCTGGCTGCTGTGGTCGCTCAGCAAGCCTCCCGAGCGGC TGGGTGAAATCAGCGGTTGGCTGCTGCTGTTCCTGGCTGTCGCCGTGCTGGCCACAGG CTTCTCGCCAGTTCCCGCCGCGGCCCTCAAGGGGCTGGTGAAGCTGCTCAGCTATCTG GGGGTTTATGCACTGATGCGCCAGCTTCTCGCCGTTCGCCCTGCATGGTGGGACCGGCT GCTGGCGGCTCTGCTCGGGGGATCGTTGCTGACCGATGTGCTCGCCCTGCGCCAGCTCT...

Embodiment 2

[0104] Example 2 Preparation of recombinant Agrobacterium tumefaciens EHA105-p6+ictB cells

[0105] According to the calcium chloride method described in "Molecular Cloning Experiment Guide" (third edition, Science Press), the p6+ictB recombinant construct plasmid prepared in Example 1 was transformed into Agrobacterium tumefaciens EHA105 (December 24, 2009 Competent cells preserved in the Wuhan University Collection Center, Luojia Mountain, Wuchang, Wuhan City, Hubei Province, namely the China Center for Type Culture Collection (CCTCC), the preservation number is CCTCC M209315). The specific methods are as follows:

[0106]The Agrobacterium tumefaciens competent cells EHA105 were taken out from the ultra-low temperature refrigerator and thawed on ice. After thawing, add 5 μl of p6+ictB recombinant vector, mix gently, place in ice bath for 10 minutes, freeze in liquid nitrogen for 5 minutes, thaw at 37°C for 5 minutes, add 800 μl of normal temperature LB liquid medium, recover...

Embodiment 3

[0110] Induction and Transformation of Embodiment 3 Rice Callus

[0111] The rice callus was induced according to the following steps, and the recombinant Agrobacterium tumefaciens EHA105-p6+ictB prepared in Example 2 was used to transform the callus:

[0112] (1) Rice Nipponbare seeds (preserved at the Wuhan University Collection Center, Luojia Mountain, Wuchang, Wuhan City, Hubei Province on December 18, 2009, that is, the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC P200910) were shelled, 70 Disinfect the surface with % ethanol for 30s, then disinfect with sodium hypochlorite with 1.5% available chlorine for 30min, shake vigorously during the period, wash with sterilized water for 5 times after disinfection; put the sterilized seeds on N6D medium and seal with parafilm; 28℃ Dark culture for 6-8 weeks;

[0113] (2) Select actively growing callus tissue (yellow-white, dry, 1-3mm in diameter) and culture it in the dark at 28°C on new ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construct and an application thereof. The construct comprises a nucleotide sequence shown in SEQ ID NO: 1. The nucleotide sequence shown in SEQ ID NO: 1, namely a blue-green algae ictB gene can be successfully introduced into a receiver plant by using the construct, thus the photosynthetic efficiency of the receiver plant can be remarkably reinforced, and the yield of plants is increased.

Description

technical field [0001] The invention relates to the technical field of bioengineering. In particular, the invention relates to constructs and their uses. More specifically, the present invention relates to constructs, recombinant cells and their use in the preparation of transgenic plant cells, tissues, organs or cultures thereof, transgenic plants, transgenic plant cells, tissues, organs or cultures thereof, and the preparation of transgenic plants Methods. Background technique [0002] The way of material accumulation of crops is mainly through photosynthesis. At this stage, breeding with high light efficiency is a new way to cultivate high-yielding plant varieties. However, the genetic resources that can be used in conventional breeding are very limited. To obtain better strains or varieties with high light efficiency, it is necessary to introduce excellent genetic resources through modern biotechnology, especially molecular breeding technology, so as to innovate high l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N1/21C12N5/10C12N15/82C12N15/83A01H5/00C12R1/01
Inventor 张耕耘全志武邹洪锋倪雪梅
Owner SHENZHEN HUADA GENE INST
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More