shRNA for inhibiting mouse TRAF6 gene expression and application thereof

A gene expression, mouse technology, applied in the field of shRNA, can solve problems such as affecting the function of TRAF6

Inactive Publication Date: 2010-09-22
JINAN UNIVERSITY
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are only 3 laboratories in the world with TRAF6-deficient mice, and they cannot be widely used for TRAF6 functional research
The currently reported interfering RNA failed to completely inhibit the expression of the mouse TRAF6 gene, which affected the research on the function of TRAF6

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • shRNA for inhibiting mouse TRAF6 gene expression and application thereof
  • shRNA for inhibiting mouse TRAF6 gene expression and application thereof
  • shRNA for inhibiting mouse TRAF6 gene expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] (1) Design the DNA sequence of the shRNA that suppresses the mouse TRAF6 gene, as follows:

[0041] GAGTCACTTGGTACGATACTTGTCGAAGAGAAGTGTCGTGCCAAGTGATTC;

[0042] For cloning it into the pENTR / U6 vector, the following DNA sequence was synthesized:

[0043] FP: 5'-CACC -3'

[0044] RP: 5'-AAAA -3';

[0045] The DNA sequence was synthesized by EXIGEN, Japan.

[0046] (2) Anneal the DNA sequences FP and RP at 95°C for 5 minutes, and then place them on ice for 5 minutes; then mix the annealed FP and RP in equimolar amounts, incubate at 37°C for 2 hours, and place them in 2 times frozen anhydrous Precipitate with ethanol (adding 0.1 times 3M sodium acetate at pH 5.6) to obtain double-stranded DNA fragments;

[0047] (3) Ligate the pENTR / U6 vector (purchased from Invitrogen) with the double-stranded DNA fragment obtained in step (2) to obtain the recombinant vector pENTR / U6-TRAF6-shRNA;

[0048] The connection system is as follows:

[0049] Double-stranded DNA fragme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses shRNA for inhibiting mouse TRAF6 gene expression and application thereof. The deoxyribonucleic acid (DNA) sequence of the shRNA for inhibiting the mouse TRAF6 gene expression is GAATCACTTGGCACGACACTT. The shRNA for inhibiting the mouse TRAF6 gene expression is prepared by the following steps of: designing the DNA sequence which contains the shRNA for inhibiting the mouse TRAF6; cloning the DNA sequence to a pENTR / U6 vector; and transferring the DNA sequence which is positioned on a recombinant vector pENTR / U6-TRAF6-shRNA by Gateway technology to obtain CS-RfA-EG-TRAF6-shRNA recombinant plasmids which can totally inhibit the expression of the mouse TRAF6 gene. Therefore, the recombinant plasmids are extremely significant to research on the effect of the TRAF6 and the treatment of diseases caused by the TRAF6.

Description

technical field [0001] The invention relates to an shRNA, in particular to an shRNA for inhibiting mouse TRAF6 gene expression and application thereof. Background technique [0002] TNF receptor-associated factor 6 (TRAF6, tumor necrosis factor receptor-associated factor 6) is a signaling molecule in cells, which has extensive and extremely important physiological functions, such as its role in tooth formation, lymph node formation, and osteoclast formation. Indispensable; it can guide the formation of thymus medulla microstructure to control the body's central immune tolerance; in addition, it is also a key factor in the production of regulatory T lymphocytes, and so on. [0003] TRAF6-deficient mice and RNAi techniques are commonly used in functional studies of TRAF6. Only 3 laboratories in the world have TRAF6-deficient mice, and they cannot be widely used in the functional research of TRAF6. The currently reported interfering RNA fails to completely inhibit the express...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/867
Inventor 秦俊文谢琪璇秋山泰身井上纯一郎
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap